EMAIL THIS PAGE TO A FRIEND

VAV1

vav 1 guanine nucleotide exchange factor

Synonyms: VAV
UniProtKB ID: P15498, B4DVK9, M0QXX6, Q15860
Gene ID:
Human(7409) Summary: This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
Mouse(22324) vav 1 oncogene
Rat(25156) vav 1 guanine nucleotide exchange factor
domestic cat(101097212) vav 1 guanine nucleotide exchange factor
dog(485016) vav 1 guanine nucleotide exchange factor
cow(617345) vav 1 guanine nucleotide exchange factor
sheep(101107354) vav 1 guanine nucleotide exchange factor
naked mole-rat(101700388) vav 1 guanine nucleotide exchange factor
domestic guinea pig(100713221) vav 1 guanine nucleotide exchange factor
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005428 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005428 Rosetta Predictions human pricing
NM_012759 Rosetta Predictions rat pricing
NM_011691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207703 predicted 788
2 SASI_Hs01_00207704 predicted 769
3 SASI_Hs01_00207705 predicted 1082
4 SASI_Hs01_00207706 predicted 1954
5 SASI_Hs01_00207707 predicted 1414
6 SASI_Hs01_00207708 predicted 2006
7 SASI_Hs01_00207709 predicted 1384
8 SASI_Hs01_00207710 predicted 1994
9 SASI_Hs01_00207711 predicted 2162
10 SASI_Hs01_00207712 predicted 2337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260122 predicted 1393
2 SASI_Rn01_00042343 predicted 1506
3 SASI_Rn01_00042346 predicted 2158
4 SASI_Rn01_00042347 predicted 517
5 SASI_Rn01_00042349 predicted 1764
6 SASI_Rn01_00042350 predicted 2551
7 SASI_Rn01_00042351 predicted 2453
8 SASI_Rn02_00260123 predicted 881
9 SASI_Rn02_00260124 predicted 488
10 SASI_Rn02_00260125 predicted 1956
11 SASI_Rn01_00042342 predicted 1087
12 SASI_Rn01_00042344 predicted 290
13 SASI_Rn01_00042345 predicted 612
14 SASI_Rn01_00042348 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112175 predicted 2487
2 SASI_Mm01_00112176 predicted 1274
3 SASI_Mm01_00112177 predicted 909
4 SASI_Mm01_00112178 predicted 1981
5 SASI_Mm01_00112179 predicted 352
6 SASI_Mm01_00112180 predicted 2037
7 SASI_Mm01_00112181 predicted 1695
8 SASI_Mm01_00112182 predicted 237
9 SASI_Mm01_00112183 predicted 514
10 SASI_Mm02_00321237 predicted 2314
11 SASI_Mm01_00112174 predicted 1856
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005428
VALIDATED
VAV1 MISSION shRNA Bacterial Glycerol Stock
vav 1 guanine nucleotide exchange factor
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005428.x-2271s1c1
Sequence:CCGGACTGTACCGGATCACAGAGACTCGAGTCTCTGTGATCCGGTACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005428.x-575s1c1
Sequence:CCGGTATGACTGCGTGGAGAATGAGCTCGAGCTCATTCTCCACGCAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005428.2-1375s1c1
Sequence:CCGGGCTCGACAAAGCTCTACTCATCTCGAGATGAGTAGAGCTTTGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005428.2-391s1c1
Sequence:CCGGCCTCTTCGATGTGCAGGATTTCTCGAGAAATCCTGCACATCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005428.2-2044s1c1
Sequence:CCGGGTTTCCTTGTAACAGGGTGAACTCGAGTTCACCCTGTTACAAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005428.2-2233s1c1
Sequence:CCGGCGTCGAGGTCAAGCACATTAACTCGAGTTAATGTGCTTGACCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005428.2-2644s1c1
Sequence:CCGGGCCTTGGCAGAGAGACGAGAACTCGAGTTCTCGTCTCTCTGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005428.2-2012s21c1
Sequence:CCGGGGCAGAAATACATCTACTAATCTCGAGATTAGTAGATGTATTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005428.2-2271s21c1
Sequence:CCGGGACTGTACCGGATCACAGAGACTCGAGTCTCTGTGATCCGGTACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005428.2-2601s21c1
Sequence:CCGGACTACGTGGAGGAAGATTATTCTCGAGAATAATCTTCCTCCACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005428.2-2233s21c1
Sequence:CCGGCGTCGAGGTCAAGCACATTAACTCGAGTTAATGTGCTTGACCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005428.2-2644s21c1
Sequence:CCGGGCCTTGGCAGAGAGACGAGAACTCGAGTTCTCGTCTCTCTGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005428
VALIDATED
VAV1 MISSION shRNA shRNA Plasmid DNA
vav 1 guanine nucleotide exchange factor
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005428.x-2271s1c1
Sequence:CCGGACTGTACCGGATCACAGAGACTCGAGTCTCTGTGATCCGGTACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005428.x-575s1c1
Sequence:CCGGTATGACTGCGTGGAGAATGAGCTCGAGCTCATTCTCCACGCAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005428.2-1375s1c1
Sequence:CCGGGCTCGACAAAGCTCTACTCATCTCGAGATGAGTAGAGCTTTGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005428.2-391s1c1
Sequence:CCGGCCTCTTCGATGTGCAGGATTTCTCGAGAAATCCTGCACATCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005428.2-2044s1c1
Sequence:CCGGGTTTCCTTGTAACAGGGTGAACTCGAGTTCACCCTGTTACAAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005428.2-2233s1c1
Sequence:CCGGCGTCGAGGTCAAGCACATTAACTCGAGTTAATGTGCTTGACCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005428.2-2644s1c1
Sequence:CCGGGCCTTGGCAGAGAGACGAGAACTCGAGTTCTCGTCTCTCTGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005428.2-2012s21c1
Sequence:CCGGGGCAGAAATACATCTACTAATCTCGAGATTAGTAGATGTATTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005428.2-2271s21c1
Sequence:CCGGGACTGTACCGGATCACAGAGACTCGAGTCTCTGTGATCCGGTACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005428.2-2601s21c1
Sequence:CCGGACTACGTGGAGGAAGATTATTCTCGAGAATAATCTTCCTCCACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005428.2-2233s21c1
Sequence:CCGGCGTCGAGGTCAAGCACATTAACTCGAGTTAATGTGCTTGACCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005428.2-2644s21c1
Sequence:CCGGGCCTTGGCAGAGAGACGAGAACTCGAGTTCTCGTCTCTCTGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005428
VALIDATED
VAV1 MISSION shRNA Lentiviral Transduction Particles
vav 1 guanine nucleotide exchange factor
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005428.x-2271s1c1
Sequence:CCGGACTGTACCGGATCACAGAGACTCGAGTCTCTGTGATCCGGTACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005428.x-575s1c1
Sequence:CCGGTATGACTGCGTGGAGAATGAGCTCGAGCTCATTCTCCACGCAGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005428.2-1375s1c1
Sequence:CCGGGCTCGACAAAGCTCTACTCATCTCGAGATGAGTAGAGCTTTGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005428.2-391s1c1
Sequence:CCGGCCTCTTCGATGTGCAGGATTTCTCGAGAAATCCTGCACATCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005428.2-2044s1c1
Sequence:CCGGGTTTCCTTGTAACAGGGTGAACTCGAGTTCACCCTGTTACAAGGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005428.2-2233s1c1
Sequence:CCGGCGTCGAGGTCAAGCACATTAACTCGAGTTAATGTGCTTGACCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005428.2-2644s1c1
Sequence:CCGGGCCTTGGCAGAGAGACGAGAACTCGAGTTCTCGTCTCTCTGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_005428.2-2012s21c1
Sequence:CCGGGGCAGAAATACATCTACTAATCTCGAGATTAGTAGATGTATTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005428.2-2271s21c1
Sequence:CCGGGACTGTACCGGATCACAGAGACTCGAGTCTCTGTGATCCGGTACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005428.2-2601s21c1
Sequence:CCGGACTACGTGGAGGAAGATTATTCTCGAGAATAATCTTCCTCCACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005428.2-2233s21c1
Sequence:CCGGCGTCGAGGTCAAGCACATTAACTCGAGTTAATGTGCTTGACCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005428.2-2644s21c1
Sequence:CCGGGCCTTGGCAGAGAGACGAGAACTCGAGTTCTCGTCTCTCTGCCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011691
VAV1 MISSION shRNA Bacterial Glycerol Stock
vav 1 guanine nucleotide exchange factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-828s1c1
Sequence:CCGGCCACTTCTTAAAGGAACTGAACTCGAGTTCAGTTCCTTTAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-1616s1c1
Sequence:CCGGCTACAGCCAATGGGCATGATTCTCGAGAATCATGCCCATTGGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-2221s1c1
Sequence:CCGGGTGGAGGTCAAGCATATTAAACTCGAGTTTAATATGCTTGACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-487s1c1
Sequence:CCGGGCTCTGAACGACGAAGATATTCTCGAGAATATCTTCGTCGTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-245s1c1
Sequence:CCGGCCATTAATCTTCGCGAGGTTACTCGAGTAACCTCGCGAAGATTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011691
VAV1 MISSION shRNA shRNA Plasmid DNA
vav 1 guanine nucleotide exchange factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-828s1c1
Sequence:CCGGCCACTTCTTAAAGGAACTGAACTCGAGTTCAGTTCCTTTAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-1616s1c1
Sequence:CCGGCTACAGCCAATGGGCATGATTCTCGAGAATCATGCCCATTGGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-2221s1c1
Sequence:CCGGGTGGAGGTCAAGCATATTAAACTCGAGTTTAATATGCTTGACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-487s1c1
Sequence:CCGGGCTCTGAACGACGAAGATATTCTCGAGAATATCTTCGTCGTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-245s1c1
Sequence:CCGGCCATTAATCTTCGCGAGGTTACTCGAGTAACCTCGCGAAGATTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011691
VAV1 MISSION shRNA Lentiviral Transduction Particles
vav 1 guanine nucleotide exchange factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-828s1c1
Sequence:CCGGCCACTTCTTAAAGGAACTGAACTCGAGTTCAGTTCCTTTAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-1616s1c1
Sequence:CCGGCTACAGCCAATGGGCATGATTCTCGAGAATCATGCCCATTGGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-2221s1c1
Sequence:CCGGGTGGAGGTCAAGCATATTAAACTCGAGTTTAATATGCTTGACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-487s1c1
Sequence:CCGGGCTCTGAACGACGAAGATATTCTCGAGAATATCTTCGTCGTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011691.2-245s1c1
Sequence:CCGGCCATTAATCTTCGCGAGGTTACTCGAGTAACCTCGCGAAGATTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks