EMAIL THIS PAGE TO A FRIEND

VAV2

vav 2 guanine nucleotide exchange factor

Synonyms: VAV-2
Gene ID:
Human(7410) Summary: VAV2 is the second member of the VAV guanine nucleotide exchange factor family of oncogenes. Unlike VAV1, which is expressed exclusively in hematopoietic cells, VAV2 transcripts were found in most tissues. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(22325) vav 2 oncogene
Rat(296603) vav 2 guanine nucleotide exchange factor
domestic guinea pig(100728155) vav 2 guanine nucleotide exchange factor
naked mole-rat(101721831) vav 2 guanine nucleotide exchange factor
cow(515718) vav 2 guanine nucleotide exchange factor
sheep(101110137) vav 2 guanine nucleotide exchange factor
chicken(373938) vav 2 guanine nucleotide exchange factor
dog(608060) vav 2 guanine nucleotide exchange factor
domestic cat(101086264) vav 2 guanine nucleotide exchange factor
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003371 Rosetta Predictions human pricing
NM_001106563 Rosetta Predictions rat pricing
NM_009500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118656 predicted 1491
2 SASI_Hs01_00118657 predicted 1559
3 SASI_Hs01_00118658 predicted 1617
4 SASI_Hs01_00118660 predicted 400
5 SASI_Hs01_00118661 predicted 1693
6 SASI_Hs02_00335530 predicted 905
7 SASI_Hs01_00118662 predicted 251
8 SASI_Hs01_00118663 predicted 1424
9 SASI_Hs02_00335531 predicted 1682
10 SASI_Hs01_00118664 predicted 1545
11 SASI_Hs01_00118659 predicted 809
12 SASI_Hs01_00118665 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220188 predicted 703
2 SASI_Rn02_00220189 predicted 1684
3 SASI_Rn02_00220190 predicted 2221
4 SASI_Rn02_00220191 predicted 2208
5 SASI_Rn02_00220192 predicted 1376
6 SASI_Rn02_00220193 predicted 716
7 SASI_Rn02_00220194 predicted 2690
8 SASI_Rn02_00220195 predicted 779
9 SASI_Rn02_00220196 predicted 2010
10 SASI_Rn02_00220197 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143062 predicted 1174
2 SASI_Mm02_00316274 predicted 2089
3 SASI_Mm01_00143063 predicted 1776
4 SASI_Mm01_00143064 predicted 1481
5 SASI_Mm01_00143065 predicted 1040
6 SASI_Mm01_00143068 predicted 657
7 SASI_Mm01_00143069 predicted 1903
8 SASI_Mm02_00316275 predicted 1571
9 SASI_Mm01_00143070 predicted 1075
10 SASI_Mm01_00143071 predicted 1262
11 SASI_Mm01_00143066 predicted 605
12 SASI_Mm01_00143067 predicted 1753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003371
VALIDATED
VAV2 MISSION shRNA Bacterial Glycerol Stock
vav 2 guanine nucleotide exchange factor
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-1026s21c1
Sequence:CCGGCCATGCAGAGGGTGCTCAAATCTCGAGATTTGAGCACCCTCTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-399s21c1
Sequence:CCGGACAGCATCGCGCAGAACAAAGCTCGAGCTTTGTTCTGCGCGATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003371.3-2763s21c1
Sequence:CCGGTGGGTATGCTATTGTACATAGCTCGAGCTATGTACAATAGCATACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003371.3-2577s21c1
Sequence:CCGGGTGGACAAGACTCGCAGATTTCTCGAGAAATCTGCGAGTCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-841s21c1
Sequence:CCGGCAAGGTCTTCCTCGATTTCAACTCGAGTTGAAATCGAGGAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-2139s21c1
Sequence:CCGGCAATAAGCATCAAGTTCAATGCTCGAGCATTGAACTTGATGCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-250s1c1
Sequence:CCGGGCCACGATAAATTTGGATTAACTCGAGTTAATCCAAATTTATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-311s1c1
Sequence:CCGGGCGAGACTTTGGAAAGGTCATCTCGAGATGACCTTTCCAAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003371.2-1179s1c1
Sequence:CCGGCAAGTGAAACTGGAGGAATTTCTCGAGAAATTCCTCCAGTTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-2374s1c1
Sequence:CCGGCCCGAGATATGAGGGAGCTTTCTCGAGAAAGCTCCCTCATATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-1260s1c1
Sequence:CCGGGACAGGTACTTGTTCCTGTTTCTCGAGAAACAGGAACAAGTACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003371
VALIDATED
VAV2 MISSION shRNA shRNA Plasmid DNA
vav 2 guanine nucleotide exchange factor
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-1026s21c1
Sequence:CCGGCCATGCAGAGGGTGCTCAAATCTCGAGATTTGAGCACCCTCTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-399s21c1
Sequence:CCGGACAGCATCGCGCAGAACAAAGCTCGAGCTTTGTTCTGCGCGATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003371.3-2763s21c1
Sequence:CCGGTGGGTATGCTATTGTACATAGCTCGAGCTATGTACAATAGCATACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003371.3-2577s21c1
Sequence:CCGGGTGGACAAGACTCGCAGATTTCTCGAGAAATCTGCGAGTCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-841s21c1
Sequence:CCGGCAAGGTCTTCCTCGATTTCAACTCGAGTTGAAATCGAGGAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-2139s21c1
Sequence:CCGGCAATAAGCATCAAGTTCAATGCTCGAGCATTGAACTTGATGCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-250s1c1
Sequence:CCGGGCCACGATAAATTTGGATTAACTCGAGTTAATCCAAATTTATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-311s1c1
Sequence:CCGGGCGAGACTTTGGAAAGGTCATCTCGAGATGACCTTTCCAAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003371.2-1179s1c1
Sequence:CCGGCAAGTGAAACTGGAGGAATTTCTCGAGAAATTCCTCCAGTTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-2374s1c1
Sequence:CCGGCCCGAGATATGAGGGAGCTTTCTCGAGAAAGCTCCCTCATATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-1260s1c1
Sequence:CCGGGACAGGTACTTGTTCCTGTTTCTCGAGAAACAGGAACAAGTACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003371
VALIDATED
VAV2 MISSION shRNA Lentiviral Transduction Particles
vav 2 guanine nucleotide exchange factor
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-1026s21c1
Sequence:CCGGCCATGCAGAGGGTGCTCAAATCTCGAGATTTGAGCACCCTCTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-399s21c1
Sequence:CCGGACAGCATCGCGCAGAACAAAGCTCGAGCTTTGTTCTGCGCGATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003371.3-2763s21c1
Sequence:CCGGTGGGTATGCTATTGTACATAGCTCGAGCTATGTACAATAGCATACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003371.3-2577s21c1
Sequence:CCGGGTGGACAAGACTCGCAGATTTCTCGAGAAATCTGCGAGTCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-841s21c1
Sequence:CCGGCAAGGTCTTCCTCGATTTCAACTCGAGTTGAAATCGAGGAAGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003371.3-2139s21c1
Sequence:CCGGCAATAAGCATCAAGTTCAATGCTCGAGCATTGAACTTGATGCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-250s1c1
Sequence:CCGGGCCACGATAAATTTGGATTAACTCGAGTTAATCCAAATTTATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-311s1c1
Sequence:CCGGGCGAGACTTTGGAAAGGTCATCTCGAGATGACCTTTCCAAAGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003371.2-1179s1c1
Sequence:CCGGCAAGTGAAACTGGAGGAATTTCTCGAGAAATTCCTCCAGTTTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-2374s1c1
Sequence:CCGGCCCGAGATATGAGGGAGCTTTCTCGAGAAAGCTCCCTCATATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003371.2-1260s1c1
Sequence:CCGGGACAGGTACTTGTTCCTGTTTCTCGAGAAACAGGAACAAGTACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009500
VAV2 MISSION shRNA Bacterial Glycerol Stock
vav 2 guanine nucleotide exchange factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-1751s21c1
Sequence:CCGGCCTATGGCTTCTACCTGATTCCTCGAGGAATCAGGTAGAAGCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-850s21c1
Sequence:CCGGGATGAAGGAGATGACATTTATCTCGAGATAAATGTCATCTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-2307s21c1
Sequence:CCGGACCATCCCGGGAGATCGATTACTCGAGTAATCGATCTCCCGGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-1670s21c1
Sequence:CCGGATGAGCTGAAGGAGGTCATTGCTCGAGCAATGACCTCCTTCAGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009500.1-3250s1c1
Sequence:CCGGGCCTGCATCTCTGGTTTAGATCTCGAGATCTAAACCAGAGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-599s1c1
Sequence:CCGGGCCATGACAAATTTGGACTAACTCGAGTTAGTCCAAATTTGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-1623s1c1
Sequence:CCGGCCTATTTGACAAGGTGGTCATCTCGAGATGACCACCTTGTCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-1147s1c1
Sequence:CCGGGCTAAGGTCTTTCTGGAGTTTCTCGAGAAACTCCAGAAAGACCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-1148s1c1
Sequence:CCGGCTAAGGTCTTTCTGGAGTTTACTCGAGTAAACTCCAGAAAGACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009500
VAV2 MISSION shRNA shRNA Plasmid DNA
vav 2 guanine nucleotide exchange factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-1751s21c1
Sequence:CCGGCCTATGGCTTCTACCTGATTCCTCGAGGAATCAGGTAGAAGCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-850s21c1
Sequence:CCGGGATGAAGGAGATGACATTTATCTCGAGATAAATGTCATCTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-2307s21c1
Sequence:CCGGACCATCCCGGGAGATCGATTACTCGAGTAATCGATCTCCCGGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-1670s21c1
Sequence:CCGGATGAGCTGAAGGAGGTCATTGCTCGAGCAATGACCTCCTTCAGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009500.1-3250s1c1
Sequence:CCGGGCCTGCATCTCTGGTTTAGATCTCGAGATCTAAACCAGAGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-599s1c1
Sequence:CCGGGCCATGACAAATTTGGACTAACTCGAGTTAGTCCAAATTTGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-1623s1c1
Sequence:CCGGCCTATTTGACAAGGTGGTCATCTCGAGATGACCACCTTGTCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-1147s1c1
Sequence:CCGGGCTAAGGTCTTTCTGGAGTTTCTCGAGAAACTCCAGAAAGACCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-1148s1c1
Sequence:CCGGCTAAGGTCTTTCTGGAGTTTACTCGAGTAAACTCCAGAAAGACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009500
VAV2 MISSION shRNA Lentiviral Transduction Particles
vav 2 guanine nucleotide exchange factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-1751s21c1
Sequence:CCGGCCTATGGCTTCTACCTGATTCCTCGAGGAATCAGGTAGAAGCCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-850s21c1
Sequence:CCGGGATGAAGGAGATGACATTTATCTCGAGATAAATGTCATCTCCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-2307s21c1
Sequence:CCGGACCATCCCGGGAGATCGATTACTCGAGTAATCGATCTCCCGGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009500.1-1670s21c1
Sequence:CCGGATGAGCTGAAGGAGGTCATTGCTCGAGCAATGACCTCCTTCAGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009500.1-3250s1c1
Sequence:CCGGGCCTGCATCTCTGGTTTAGATCTCGAGATCTAAACCAGAGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-599s1c1
Sequence:CCGGGCCATGACAAATTTGGACTAACTCGAGTTAGTCCAAATTTGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-1623s1c1
Sequence:CCGGCCTATTTGACAAGGTGGTCATCTCGAGATGACCACCTTGTCAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-1147s1c1
Sequence:CCGGGCTAAGGTCTTTCTGGAGTTTCTCGAGAAACTCCAGAAAGACCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009500.1-1148s1c1
Sequence:CCGGCTAAGGTCTTTCTGGAGTTTACTCGAGTAAACTCCAGAAAGACCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks