EMAIL THIS PAGE TO A FRIEND

VAV3

vav 3 guanine nucleotide exchange factor

Gene ID:
Human(10451) Summary: This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. This gene product acts as a GEF preferentially for RhoG, RhoA, and to a lesser extent, RAC1, and it associates maximally with the nucleotide-free states of these GTPases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(57257) vav 3 oncogene
Rat(295378) vav 3 guanine nucleotide exchange factor
chicken(373939) vav 3 guanine nucleotide exchange factor
domestic cat(101087417) vav 3 guanine nucleotide exchange factor
Horse(100057737) vav 3 guanine nucleotide exchange factor
dog(479921) vav 3 guanine nucleotide exchange factor
cow(521961) vav 3 guanine nucleotide exchange factor
sheep(101120709) vav 3 guanine nucleotide exchange factor
naked mole-rat(101716743) vav 3 guanine nucleotide exchange factor
Domestic Rabbit(100341627) vav 3 guanine nucleotide exchange factor
domestic guinea pig(100714719) vav 3 guanine nucleotide exchange factor
220 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006113 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077611 MISSION® esiRNA esiRNA human VAV3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079874 Rosetta Predictions human pricing
NM_006113 Rosetta Predictions human pricing
XM_001072341 Rosetta Predictions rat pricing
XM_227600 Rosetta Predictions rat pricing
NM_020505 Rosetta Predictions mouse pricing
NM_146139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314030 predicted 773
2 SASI_Hs02_00314031 predicted 503
3 SASI_Hs02_00314032 predicted 647
4 SASI_Hs02_00314033 predicted 827
5 SASI_Hs02_00314034 predicted 1006
6 SASI_Hs02_00314035 predicted 490
7 SASI_Hs02_00314036 predicted 441
8 SASI_Hs02_00314037 predicted 630
9 SASI_Hs02_00314038 predicted 662
10 SASI_Hs02_00314039 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068931 predicted 2436
2 SASI_Hs02_00340920 predicted 2166
3 SASI_Hs02_00340921 predicted 2315
4 SASI_Hs02_00340922 predicted 2479
5 SASI_Hs01_00068938 predicted 2665
6 SASI_Hs02_00340923 predicted 2151
7 SASI_Hs02_00340924 predicted 2101
8 SASI_Hs02_00340925 predicted 2293
9 SASI_Hs02_00340926 predicted 2328
10 SASI_Hs02_00340927 predicted 2284
11 SASI_Hs01_00068929 predicted 1393
12 SASI_Hs01_00068930 predicted 1446
13 SASI_Hs01_00068932 predicted 1280
14 SASI_Hs01_00068933 predicted 1621
15 SASI_Hs01_00068934 predicted 2458
16 SASI_Hs01_00068935 predicted 863
17 SASI_Hs01_00068936 predicted 1696
18 SASI_Hs01_00068937 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338773 predicted 2544
2 SASI_Rn02_00338774 predicted 1353
3 SASI_Rn02_00338775 predicted 1970
4 SASI_Rn02_00338776 predicted 1223
5 SASI_Rn02_00338777 predicted 2880
6 SASI_Rn02_00338778 predicted 2259
7 SASI_Rn02_00338779 predicted 983
8 SASI_Rn02_00338780 predicted 2507
9 SASI_Rn02_00338781 predicted 1636
10 SASI_Rn02_00338782 predicted 2294
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384542 predicted 1713
2 SASI_Rn02_00384543 predicted 2320
3 SASI_Rn02_00384544 predicted 1579
4 SASI_Rn02_00384545 predicted 2617
5 SASI_Rn02_00384546 predicted 1338
6 SASI_Rn02_00384547 predicted 1388
7 SASI_Rn02_00384548 predicted 1547
8 SASI_Rn02_00384549 predicted 1988
9 SASI_Rn02_00384550 predicted 2648
10 SASI_Rn02_00384551 predicted 2202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042662 predicted 2723
2 SASI_Mm01_00042663 predicted 2859
3 SASI_Mm01_00042664 predicted 2908
4 SASI_Mm01_00042665 predicted 2396
5 SASI_Mm01_00042666 predicted 2620
6 SASI_Mm02_00325558 predicted 2704
7 SASI_Mm01_00042667 predicted 2470
8 SASI_Mm01_00042668 predicted 2330
9 SASI_Mm01_00042669 predicted 2399
10 SASI_Mm01_00042670 predicted 2366
11 SASI_Mm01_00042671 predicted 2469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069812 predicted 765
2 SASI_Mm01_00069813 predicted 892
3 SASI_Mm01_00069814 predicted 941
4 SASI_Mm01_00069815 predicted 438
5 SASI_Mm01_00069816 predicted 659
6 SASI_Mm02_00341829 predicted 738
7 SASI_Mm01_00069817 predicted 507
8 SASI_Mm01_00069818 predicted 377
9 SASI_Mm01_00069819 predicted 436
10 SASI_Mm01_00069820 predicted 404
11 SASI_Mm01_00069821 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146139
VAV3 MISSION shRNA Bacterial Glycerol Stock
vav 3 guanine nucleotide exchange factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146139.2-1416s1c1
Sequence:CCGGCCAGCATTTCTCGTCTTAAATCTCGAGATTTAAGACGAGAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-447s1c1
Sequence:CCGGGAACTTATTAACAGGGTGAATCTCGAGATTCACCCTGTTAATAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-638s1c1
Sequence:CCGGCCATTCTCTCAAAGAAGGGTTCTCGAGAACCCTTCTTTGAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-373s1c1
Sequence:CCGGGTGTACCTAAACCAGTAGATTCTCGAGAATCTACTGGTTTAGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-909s1c1
Sequence:CCGGCCATCCACATATGTGGAAGAACTCGAGTTCTTCCACATATGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146139
VAV3 MISSION shRNA shRNA Plasmid DNA
vav 3 guanine nucleotide exchange factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146139.2-1416s1c1
Sequence:CCGGCCAGCATTTCTCGTCTTAAATCTCGAGATTTAAGACGAGAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-447s1c1
Sequence:CCGGGAACTTATTAACAGGGTGAATCTCGAGATTCACCCTGTTAATAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-638s1c1
Sequence:CCGGCCATTCTCTCAAAGAAGGGTTCTCGAGAACCCTTCTTTGAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-373s1c1
Sequence:CCGGGTGTACCTAAACCAGTAGATTCTCGAGAATCTACTGGTTTAGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-909s1c1
Sequence:CCGGCCATCCACATATGTGGAAGAACTCGAGTTCTTCCACATATGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146139
VAV3 MISSION shRNA Lentiviral Transduction Particles
vav 3 guanine nucleotide exchange factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146139.2-1416s1c1
Sequence:CCGGCCAGCATTTCTCGTCTTAAATCTCGAGATTTAAGACGAGAAATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-447s1c1
Sequence:CCGGGAACTTATTAACAGGGTGAATCTCGAGATTCACCCTGTTAATAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-638s1c1
Sequence:CCGGCCATTCTCTCAAAGAAGGGTTCTCGAGAACCCTTCTTTGAGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-373s1c1
Sequence:CCGGGTGTACCTAAACCAGTAGATTCTCGAGAATCTACTGGTTTAGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146139.2-909s1c1
Sequence:CCGGCCATCCACATATGTGGAAGAACTCGAGTTCTTCCACATATGTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006113
VAV3 MISSION shRNA Bacterial Glycerol Stock
vav 3 guanine nucleotide exchange factor
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-783s1c1
Sequence:CCGGCGGAACCTAATGCAAGAGATTCTCGAGAATCTCTTGCATTAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-1405s1c1
Sequence:CCGGCCAATAATCCTACAACCGATACTCGAGTATCGGTTGTAGGATTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-2037s1c1
Sequence:CCGGCCAGTAGATTATTCTTGCCAACTCGAGTTGGCAAGAATAATCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-624s1c1
Sequence:CCGGCGAAGTTGTTGTCTAGCAGAACTCGAGTTCTGCTAGACAACAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-2098s1c1
Sequence:CCGGCCGAACTTATTAATAGGGTAACTCGAGTTACCCTATTAATAAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006113.4-1262s21c1
Sequence:CCGGGAGATGGTGAAATTCGAATAACTCGAGTTATTCGAATTTCACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006113
VAV3 MISSION shRNA shRNA Plasmid DNA
vav 3 guanine nucleotide exchange factor
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-783s1c1
Sequence:CCGGCGGAACCTAATGCAAGAGATTCTCGAGAATCTCTTGCATTAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-1405s1c1
Sequence:CCGGCCAATAATCCTACAACCGATACTCGAGTATCGGTTGTAGGATTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-2037s1c1
Sequence:CCGGCCAGTAGATTATTCTTGCCAACTCGAGTTGGCAAGAATAATCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-624s1c1
Sequence:CCGGCGAAGTTGTTGTCTAGCAGAACTCGAGTTCTGCTAGACAACAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-2098s1c1
Sequence:CCGGCCGAACTTATTAATAGGGTAACTCGAGTTACCCTATTAATAAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006113.4-1262s21c1
Sequence:CCGGGAGATGGTGAAATTCGAATAACTCGAGTTATTCGAATTTCACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006113
VAV3 MISSION shRNA Lentiviral Transduction Particles
vav 3 guanine nucleotide exchange factor
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-783s1c1
Sequence:CCGGCGGAACCTAATGCAAGAGATTCTCGAGAATCTCTTGCATTAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-1405s1c1
Sequence:CCGGCCAATAATCCTACAACCGATACTCGAGTATCGGTTGTAGGATTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-2037s1c1
Sequence:CCGGCCAGTAGATTATTCTTGCCAACTCGAGTTGGCAAGAATAATCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-624s1c1
Sequence:CCGGCGAAGTTGTTGTCTAGCAGAACTCGAGTTCTGCTAGACAACAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006113.3-2098s1c1
Sequence:CCGGCCGAACTTATTAATAGGGTAACTCGAGTTACCCTATTAATAAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006113.4-1262s21c1
Sequence:CCGGGAGATGGTGAAATTCGAATAACTCGAGTTATTCGAATTTCACCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks