EMAIL THIS PAGE TO A FRIEND

VAX1

ventral anterior homeobox 1

Synonyms: MCOPS11
UniProtKB ID: Q5SQQ9, B1AVW5, Q6ZSX0
Gene ID:
Human(11023) Summary: This gene encodes a homeo-domain containing protein from a class of homeobox transcription factors which are conserved in vertebrates. Genes of this family are involved in the regulation of body development and morphogenesis. The most conserved genes, called HOX genes are found in special gene clusters. This gene belongs to the VAX subfamily and lies in the vicinity of the EMX homeobox gene family. Another member of VAX family is located on chromosome 2. The encoded protein may play an important role in the development of anterior ventral forebrain and visual system. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(22326) ventral anterior homeobox containing gene 1
Rat(64571) ventral anterior homeobox 1
Zebrafish(373870) ventral anterior homeobox 1
domestic cat(101086258) ventral anterior homeobox 1
dog(486906) ventral anterior homeobox 1
chicken(395582) ventral anterior homeobox 1
domestic guinea pig(100719657) ventral anterior homeobox 1
naked mole-rat(101726328) ventral anterior homeobox 1
cow(782056) ventral anterior homeobox 1
sheep(101121136) ventral anterior homeobox 1
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199131 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001112704 Rosetta Predictions human pricing
NM_199131 Rosetta Predictions human pricing
NM_022636 Rosetta Predictions rat pricing
NM_009501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325405 predicted 454
2 SASI_Hs02_00325406 predicted 444
3 SASI_Hs02_00325407 predicted 455
4 SASI_Hs02_00325408 predicted 436
5 SASI_Hs02_00325409 predicted 405
6 SASI_Hs02_00325410 predicted 1191
7 SASI_Hs02_00325411 predicted 1485
8 SASI_Hs02_00325412 predicted 1281
9 SASI_Hs02_00325413 predicted 1373
10 SASI_Hs02_00325414 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164490 predicted 448
2 SASI_Hs02_00372562 predicted 443
3 SASI_Hs02_00372563 predicted 447
4 SASI_Hs02_00372564 predicted 434
5 SASI_Hs01_00164492 predicted 848
6 SASI_Hs01_00164493 predicted 886
7 SASI_Hs01_00164484 predicted 1011
8 SASI_Hs01_00164485 predicted 1005
9 SASI_Hs01_00164486 predicted 983
10 SASI_Hs01_00164487 predicted 969
11 SASI_Hs01_00164488 predicted 1208
12 SASI_Hs01_00164489 predicted 1042
13 SASI_Hs01_00164491 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103330 predicted 353
2 SASI_Rn01_00103331 predicted 345
3 SASI_Rn01_00103332 predicted 458
4 SASI_Rn01_00103333 predicted 243
5 SASI_Rn01_00103334 predicted 211
6 SASI_Rn01_00103335 predicted 461
7 SASI_Rn01_00103336 predicted 251
8 SASI_Rn01_00103337 predicted 405
9 SASI_Rn01_00103338 predicted 410
10 SASI_Rn01_00103339 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316276 predicted 349
2 SASI_Mm01_00184109 predicted 387
3 SASI_Mm01_00184110 predicted 217
4 SASI_Mm01_00184111 predicted 393
5 SASI_Mm01_00184112 predicted 392
6 SASI_Mm01_00184114 predicted 250
7 SASI_Mm01_00184115 predicted 400
8 SASI_Mm01_00184116 predicted 349
9 SASI_Mm01_00184117 predicted 286
10 SASI_Mm01_00184118 predicted 221
11 SASI_Mm01_00184113 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199131
VAX1 MISSION shRNA Bacterial Glycerol Stock
ventral anterior homeobox 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199131.2-1016s21c1
Sequence:CCGGCTCATCTCTGGGCACTATAAACTCGAGTTTATAGTGCCCAGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199131.2-1201s21c1
Sequence:CCGGAGGAGACTGAAATCGATATTACTCGAGTAATATCGATTTCAGTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199131.2-745s21c1
Sequence:CCGGAGCCAGCAAATGATGAGTCTCCTCGAGGAGACTCATCATTTGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199131.1-3110s1c1
Sequence:CCGGGCCCTCATCAAGAAGTTTGAACTCGAGTTCAAACTTCTTGATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-693s1c1
Sequence:CCGGGAACGATTCAAACGCGGGATACTCGAGTATCCCGCGTTTGAATCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-667s1c1
Sequence:CCGGCCCAGGCAAATAGTGAAGAAACTCGAGTTTCTTCACTATTTGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-408s1c1
Sequence:CCGGGCTGCTGAGGATTGTAACAAACTCGAGTTTGTTACAATCCTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-465s1c1
Sequence:CCGGCGCCGGATCCTGGTCCGAGATCTCGAGATCTCGGACCAGGATCCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199131
VAX1 MISSION shRNA shRNA Plasmid DNA
ventral anterior homeobox 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199131.2-1016s21c1
Sequence:CCGGCTCATCTCTGGGCACTATAAACTCGAGTTTATAGTGCCCAGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199131.2-1201s21c1
Sequence:CCGGAGGAGACTGAAATCGATATTACTCGAGTAATATCGATTTCAGTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199131.2-745s21c1
Sequence:CCGGAGCCAGCAAATGATGAGTCTCCTCGAGGAGACTCATCATTTGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199131.1-3110s1c1
Sequence:CCGGGCCCTCATCAAGAAGTTTGAACTCGAGTTCAAACTTCTTGATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-693s1c1
Sequence:CCGGGAACGATTCAAACGCGGGATACTCGAGTATCCCGCGTTTGAATCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-667s1c1
Sequence:CCGGCCCAGGCAAATAGTGAAGAAACTCGAGTTTCTTCACTATTTGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-408s1c1
Sequence:CCGGGCTGCTGAGGATTGTAACAAACTCGAGTTTGTTACAATCCTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-465s1c1
Sequence:CCGGCGCCGGATCCTGGTCCGAGATCTCGAGATCTCGGACCAGGATCCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199131
VAX1 MISSION shRNA Lentiviral Transduction Particles
ventral anterior homeobox 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199131.2-1016s21c1
Sequence:CCGGCTCATCTCTGGGCACTATAAACTCGAGTTTATAGTGCCCAGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434279    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199131.2-1201s21c1
Sequence:CCGGAGGAGACTGAAATCGATATTACTCGAGTAATATCGATTTCAGTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199131.2-745s21c1
Sequence:CCGGAGCCAGCAAATGATGAGTCTCCTCGAGGAGACTCATCATTTGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199131.1-3110s1c1
Sequence:CCGGGCCCTCATCAAGAAGTTTGAACTCGAGTTCAAACTTCTTGATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-693s1c1
Sequence:CCGGGAACGATTCAAACGCGGGATACTCGAGTATCCCGCGTTTGAATCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-667s1c1
Sequence:CCGGCCCAGGCAAATAGTGAAGAAACTCGAGTTTCTTCACTATTTGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-408s1c1
Sequence:CCGGGCTGCTGAGGATTGTAACAAACTCGAGTTTGTTACAATCCTCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199131.1-465s1c1
Sequence:CCGGCGCCGGATCCTGGTCCGAGATCTCGAGATCTCGGACCAGGATCCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009501
VAX1 MISSION shRNA Bacterial Glycerol Stock
ventral anterior homeobox 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-166s1c1
Sequence:CCGGGCTTCGGAAGATTGTAACAAACTCGAGTTTGTTACAATCTTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-450s1c1
Sequence:CCGGTCGGCGGACTAAGCAGAAGAACTCGAGTTCTTCTGCTTAGTCCGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-408s1c1
Sequence:CCGGGCTCAATCTCTCTGAGACCCACTCGAGTGGGTCTCAGAGAGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-210s1c1
Sequence:CCGGCCCAGATTACTGTCGCCGGATCTCGAGATCCGGCGACAGTAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-258s1c1
Sequence:CCGGCCGAGAAATCATCCTGCCCAACTCGAGTTGGGCAGGATGATTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009501
VAX1 MISSION shRNA shRNA Plasmid DNA
ventral anterior homeobox 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-166s1c1
Sequence:CCGGGCTTCGGAAGATTGTAACAAACTCGAGTTTGTTACAATCTTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-450s1c1
Sequence:CCGGTCGGCGGACTAAGCAGAAGAACTCGAGTTCTTCTGCTTAGTCCGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-408s1c1
Sequence:CCGGGCTCAATCTCTCTGAGACCCACTCGAGTGGGTCTCAGAGAGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-210s1c1
Sequence:CCGGCCCAGATTACTGTCGCCGGATCTCGAGATCCGGCGACAGTAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-258s1c1
Sequence:CCGGCCGAGAAATCATCCTGCCCAACTCGAGTTGGGCAGGATGATTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009501
VAX1 MISSION shRNA Lentiviral Transduction Particles
ventral anterior homeobox 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-166s1c1
Sequence:CCGGGCTTCGGAAGATTGTAACAAACTCGAGTTTGTTACAATCTTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-450s1c1
Sequence:CCGGTCGGCGGACTAAGCAGAAGAACTCGAGTTCTTCTGCTTAGTCCGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-408s1c1
Sequence:CCGGGCTCAATCTCTCTGAGACCCACTCGAGTGGGTCTCAGAGAGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-210s1c1
Sequence:CCGGCCCAGATTACTGTCGCCGGATCTCGAGATCCGGCGACAGTAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009501.1-258s1c1
Sequence:CCGGCCGAGAAATCATCCTGCCCAACTCGAGTTGGGCAGGATGATTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks