EMAIL THIS PAGE TO A FRIEND

VAX2

ventral anterior homeobox 2

Synonyms: DRES93
UniProtKB ID: Q9UIW0, Q53Y33
Gene ID:
Human(25806) Summary: This gene encodes a homeobox protein and is almost exclusively expressed in the ventral portion of the retina during development. In mouse studies, this gene was found to be required for the correct formation of the optic fissure and other aspects of retinal development. [provided by RefSeq, Sep 2008]
Mouse(24113) ventral anterior homeobox containing gene 2
Rat(64572) ventral anterior homeobox 2
cow(539808) ventral anterior homeobox 2
sheep(101107945) ventral anterior homeobox 2
naked mole-rat(101721360) ventral anterior homeobox 2
domestic guinea pig(100717182) ventral anterior homeobox 2
Zebrafish(373869) ventral anterior homeobox 2
domestic cat(101096144) ventral anterior homeobox 2
dog(612684) ventral anterior homeobox 2
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012476 Rosetta Predictions human pricing
NM_022637 Rosetta Predictions rat pricing
NM_011912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053925 predicted 296
2 SASI_Hs01_00053926 predicted 549
3 SASI_Hs01_00053927 predicted 286
4 SASI_Hs01_00053928 predicted 714
5 SASI_Hs01_00053929 predicted 549
6 SASI_Hs01_00053930 predicted 351
7 SASI_Hs01_00053931 predicted 286
8 SASI_Hs01_00053932 predicted 799
9 SASI_Hs01_00053934 predicted 835
10 SASI_Hs02_00344388 predicted 502
11 SASI_Hs01_00053933 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263424 predicted 260
2 SASI_Rn01_00068494 predicted 326
3 SASI_Rn01_00068495 predicted 534
4 SASI_Rn01_00068496 predicted 352
5 SASI_Rn01_00068497 predicted 309
6 SASI_Rn01_00068498 predicted 253
7 SASI_Rn01_00068499 predicted 417
8 SASI_Rn01_00068500 predicted 395
9 SASI_Rn01_00068501 predicted 529
10 SASI_Rn01_00068502 predicted 310
11 SASI_Rn01_00068493 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122162 predicted 390
2 SASI_Mm01_00122163 predicted 427
3 SASI_Mm01_00122164 predicted 227
4 SASI_Mm01_00122166 predicted 344
5 SASI_Mm01_00122167 predicted 289
6 SASI_Mm01_00122168 predicted 384
7 SASI_Mm01_00122169 predicted 560
8 SASI_Mm01_00122170 predicted 428
9 SASI_Mm01_00122171 predicted 346
10 SASI_Mm02_00321735 predicted 420
11 SASI_Mm01_00122165 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011912
VAX2 MISSION shRNA Bacterial Glycerol Stock
ventral anterior homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-844s1c1
Sequence:CCGGCCCTACAGCAGACTAGAACAACTCGAGTTGTTCTAGTCTGCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-489s1c1
Sequence:CCGGCCGCCGAACCAAGCAGAAGAACTCGAGTTCTTCTGCTTGGTTCGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-297s1c1
Sequence:CCGGTCGGGAAATTGTCTTGCCCAACTCGAGTTGGGCAAGACAATTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-125s1c1
Sequence:CCGGCGGAAGATTTGCGTGCTGACACTCGAGTGTCAGCACGCAAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-262s1c1
Sequence:CCGGCGCCGCATCCTGGTACGAGATCTCGAGATCTCGTACCAGGATGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011912.3-1056s21c1
Sequence:CCGGAGACTGAACCAAATGACTTTGCTCGAGCAAAGTCATTTGGTTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011912.3-366s21c1
Sequence:CCGGAGAGCAGCTGTATCGTCTGGACTCGAGTCCAGACGATACAGCTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011912.3-446s21c1
Sequence:CCGGAGCTGAACCTCTCTGAGACTCCTCGAGGAGTCTCAGAGAGGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011912
VAX2 MISSION shRNA shRNA Plasmid DNA
ventral anterior homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-844s1c1
Sequence:CCGGCCCTACAGCAGACTAGAACAACTCGAGTTGTTCTAGTCTGCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-489s1c1
Sequence:CCGGCCGCCGAACCAAGCAGAAGAACTCGAGTTCTTCTGCTTGGTTCGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-297s1c1
Sequence:CCGGTCGGGAAATTGTCTTGCCCAACTCGAGTTGGGCAAGACAATTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-125s1c1
Sequence:CCGGCGGAAGATTTGCGTGCTGACACTCGAGTGTCAGCACGCAAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-262s1c1
Sequence:CCGGCGCCGCATCCTGGTACGAGATCTCGAGATCTCGTACCAGGATGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011912.3-1056s21c1
Sequence:CCGGAGACTGAACCAAATGACTTTGCTCGAGCAAAGTCATTTGGTTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011912.3-366s21c1
Sequence:CCGGAGAGCAGCTGTATCGTCTGGACTCGAGTCCAGACGATACAGCTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011912.3-446s21c1
Sequence:CCGGAGCTGAACCTCTCTGAGACTCCTCGAGGAGTCTCAGAGAGGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011912
VAX2 MISSION shRNA Lentiviral Transduction Particles
ventral anterior homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-844s1c1
Sequence:CCGGCCCTACAGCAGACTAGAACAACTCGAGTTGTTCTAGTCTGCTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-489s1c1
Sequence:CCGGCCGCCGAACCAAGCAGAAGAACTCGAGTTCTTCTGCTTGGTTCGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-297s1c1
Sequence:CCGGTCGGGAAATTGTCTTGCCCAACTCGAGTTGGGCAAGACAATTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-125s1c1
Sequence:CCGGCGGAAGATTTGCGTGCTGACACTCGAGTGTCAGCACGCAAATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011912.1-262s1c1
Sequence:CCGGCGCCGCATCCTGGTACGAGATCTCGAGATCTCGTACCAGGATGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011912.3-1056s21c1
Sequence:CCGGAGACTGAACCAAATGACTTTGCTCGAGCAAAGTCATTTGGTTCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011912.3-366s21c1
Sequence:CCGGAGAGCAGCTGTATCGTCTGGACTCGAGTCCAGACGATACAGCTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011912.3-446s21c1
Sequence:CCGGAGCTGAACCTCTCTGAGACTCCTCGAGGAGTCTCAGAGAGGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012476
VAX2 MISSION shRNA Bacterial Glycerol Stock
ventral anterior homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012476.1-283s1c1
Sequence:CCGGCCAAAGGGACAATTCGGGAAACTCGAGTTTCCCGAATTGTCCCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012476.1-296s1c1
Sequence:CCGGTCGGGAAATTGTCCTGCCTAACTCGAGTTAGGCAGGACAATTTCCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012476.1-261s1c1
Sequence:CCGGCGCCGCATACTGGTGCGAGATCTCGAGATCTCGCACCAGTATGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012476.2-762s21c1
Sequence:CCGGCCTCTGCCAGCTGTCTGCTTTCTCGAGAAAGCAGACAGCTGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012476.2-340s21c1
Sequence:CCGGAGCGGACACGTACATCCTTCACTCGAGTGAAGGATGTACGTGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012476
VAX2 MISSION shRNA shRNA Plasmid DNA
ventral anterior homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012476.1-283s1c1
Sequence:CCGGCCAAAGGGACAATTCGGGAAACTCGAGTTTCCCGAATTGTCCCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012476.1-296s1c1
Sequence:CCGGTCGGGAAATTGTCCTGCCTAACTCGAGTTAGGCAGGACAATTTCCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012476.1-261s1c1
Sequence:CCGGCGCCGCATACTGGTGCGAGATCTCGAGATCTCGCACCAGTATGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012476.2-762s21c1
Sequence:CCGGCCTCTGCCAGCTGTCTGCTTTCTCGAGAAAGCAGACAGCTGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012476.2-340s21c1
Sequence:CCGGAGCGGACACGTACATCCTTCACTCGAGTGAAGGATGTACGTGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012476
VAX2 MISSION shRNA Lentiviral Transduction Particles
ventral anterior homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012476.1-283s1c1
Sequence:CCGGCCAAAGGGACAATTCGGGAAACTCGAGTTTCCCGAATTGTCCCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012476.1-296s1c1
Sequence:CCGGTCGGGAAATTGTCCTGCCTAACTCGAGTTAGGCAGGACAATTTCCCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012476.1-261s1c1
Sequence:CCGGCGCCGCATACTGGTGCGAGATCTCGAGATCTCGCACCAGTATGCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012476.2-762s21c1
Sequence:CCGGCCTCTGCCAGCTGTCTGCTTTCTCGAGAAAGCAGACAGCTGGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012476.2-340s21c1
Sequence:CCGGAGCGGACACGTACATCCTTCACTCGAGTGAAGGATGTACGTGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks