EMAIL THIS PAGE TO A FRIEND

VBP1

von Hippel-Lindau binding protein 1

Synonyms: PFD3 PFDN3 VBP-1
UniProtKB ID: P61758, B2R8L5, O55228, Q15765, Q5JT81, Q86X96
Gene ID:
Human(7411) Summary: The protein encoded by this gene interacts with the Von Hippel-Lindau protein to form an intracellular complex. Because it functions as a chaperone protein, it is suspected that it may play a role in the transport of the Von Hippel-Lindau protein from the perinuclear granules to the nucleus or cytoplasm. [provided by RefSeq, Jul 2008]
Mouse(22327) von Hippel-Lindau binding protein 1
Rat(681825) von Hippel-Lindau binding protein 1
Zebrafish(553651) von Hippel-Lindau binding protein 1
dog(481089) von Hippel-Lindau binding protein 1
domestic cat(101093672) von Hippel-Lindau binding protein 1
chicken(422355) von Hippel-Lindau binding protein 1
cow(508727) von Hippel-Lindau binding protein 1
sheep(101105054) von Hippel-Lindau binding protein 1
domestic guinea pig(100719460) von Hippel-Lindau binding protein 1
naked mole-rat(101719175) von Hippel-Lindau binding protein 1
Domestic Rabbit(100328770) von Hippel-Lindau binding protein 1
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003372 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003372 Rosetta Predictions human pricing
XM_001058594 Rosetta Predictions rat pricing
NM_011692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213057 predicted 391
2 SASI_Hs01_00213058 predicted 1229
3 SASI_Hs01_00213059 predicted 679
4 SASI_Hs02_00335532 predicted 696
5 SASI_Hs01_00213060 predicted 435
6 SASI_Hs01_00213061 predicted 1248
7 SASI_Hs01_00213062 predicted 519
8 SASI_Hs01_00213063 predicted 1241
9 SASI_Hs01_00213064 predicted 686
10 SASI_Hs01_00213065 predicted 526
11 SASI_Hs01_00213066 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290254 predicted 334
2 SASI_Rn02_00290255 predicted 492
3 SASI_Rn02_00290256 predicted 295
4 SASI_Rn02_00290257 predicted 326
5 SASI_Rn02_00290258 predicted 425
6 SASI_Rn02_00290259 predicted 398
7 SASI_Rn02_00290260 predicted 385
8 SASI_Rn02_00290261 predicted 376
9 SASI_Rn02_00290262 predicted 425
10 SASI_Rn02_00290263 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321238 predicted 484
2 SASI_Mm01_00080580 predicted 341
3 SASI_Mm02_00321239 predicted 249
4 SASI_Mm02_00321240 predicted 281
5 SASI_Mm02_00321241 predicted 416
6 SASI_Mm02_00321242 predicted 429
7 SASI_Mm02_00321243 predicted 329
8 SASI_Mm02_00321244 predicted 219
9 SASI_Mm02_00321245 predicted 346
10 SASI_Mm01_00080572 predicted 1013
11 SASI_Mm01_00080571 predicted 1056
12 SASI_Mm01_00080573 predicted 921
13 SASI_Mm01_00080574 predicted 946
14 SASI_Mm01_00080575 predicted 954
15 SASI_Mm01_00080576 predicted 968
16 SASI_Mm01_00080577 predicted 524
17 SASI_Mm01_00080578 predicted 112
18 SASI_Mm01_00080579 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003372
VALIDATED
VBP1 MISSION shRNA Bacterial Glycerol Stock
von Hippel-Lindau binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003372.5-443s21c1
Sequence:CCGGGGCTAATGTAATGCTTGAATACTCGAGTATTCAAGCATTACATTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003372.5-999s21c1
Sequence:CCGGCTCTCACTTGATGTGGTTAAACTCGAGTTTAACCACATCAAGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003372.5-546s21c1
Sequence:CCGGGACTTTCTTCGAGATCAATTTCTCGAGAAATTGATCTCGAAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003372.3-648s1c1
Sequence:CCGGGAATTTATCGACTGCCACAAACTCGAGTTTGTGGCAGTCGATAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003372.3-295s1c1
Sequence:CCGGGTGTTTGTGGAAGATGTAGATCTCGAGATCTACATCTTCCACAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003372.3-532s1c1
Sequence:CCGGGCAGATAACCTGTATTGCAAACTCGAGTTTGCAATACAGGTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003372.3-307s1c1
Sequence:CCGGGATGTAGATTCCTTCATGAAACTCGAGTTTCATGAAGGAATCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003372.3-554s1c1
Sequence:CCGGCTTCAGTTCCTCCTACCGATACTCGAGTATCGGTAGGAGGAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003372.3-739s1c1
Sequence:CCGGGCCAGGGTTTATAATTGGGATCTCGAGATCCCAATTATAAACCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003372
VALIDATED
VBP1 MISSION shRNA shRNA Plasmid DNA
von Hippel-Lindau binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003372.5-443s21c1
Sequence:CCGGGGCTAATGTAATGCTTGAATACTCGAGTATTCAAGCATTACATTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003372.5-999s21c1
Sequence:CCGGCTCTCACTTGATGTGGTTAAACTCGAGTTTAACCACATCAAGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003372.5-546s21c1
Sequence:CCGGGACTTTCTTCGAGATCAATTTCTCGAGAAATTGATCTCGAAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003372.3-648s1c1
Sequence:CCGGGAATTTATCGACTGCCACAAACTCGAGTTTGTGGCAGTCGATAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003372.3-295s1c1
Sequence:CCGGGTGTTTGTGGAAGATGTAGATCTCGAGATCTACATCTTCCACAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003372.3-532s1c1
Sequence:CCGGGCAGATAACCTGTATTGCAAACTCGAGTTTGCAATACAGGTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003372.3-307s1c1
Sequence:CCGGGATGTAGATTCCTTCATGAAACTCGAGTTTCATGAAGGAATCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003372.3-554s1c1
Sequence:CCGGCTTCAGTTCCTCCTACCGATACTCGAGTATCGGTAGGAGGAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003372.3-739s1c1
Sequence:CCGGGCCAGGGTTTATAATTGGGATCTCGAGATCCCAATTATAAACCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003372
VALIDATED
VBP1 MISSION shRNA Lentiviral Transduction Particles
von Hippel-Lindau binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003372.5-443s21c1
Sequence:CCGGGGCTAATGTAATGCTTGAATACTCGAGTATTCAAGCATTACATTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003372.5-999s21c1
Sequence:CCGGCTCTCACTTGATGTGGTTAAACTCGAGTTTAACCACATCAAGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003372.5-546s21c1
Sequence:CCGGGACTTTCTTCGAGATCAATTTCTCGAGAAATTGATCTCGAAGAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003372.3-648s1c1
Sequence:CCGGGAATTTATCGACTGCCACAAACTCGAGTTTGTGGCAGTCGATAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003372.3-295s1c1
Sequence:CCGGGTGTTTGTGGAAGATGTAGATCTCGAGATCTACATCTTCCACAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003372.3-532s1c1
Sequence:CCGGGCAGATAACCTGTATTGCAAACTCGAGTTTGCAATACAGGTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003372.3-307s1c1
Sequence:CCGGGATGTAGATTCCTTCATGAAACTCGAGTTTCATGAAGGAATCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003372.3-554s1c1
Sequence:CCGGCTTCAGTTCCTCCTACCGATACTCGAGTATCGGTAGGAGGAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003372.3-739s1c1
Sequence:CCGGGCCAGGGTTTATAATTGGGATCTCGAGATCCCAATTATAAACCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011692
VALIDATED
VBP1 MISSION shRNA Bacterial Glycerol Stock
von Hippel-Lindau binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-875s21c1
Sequence:CCGGCCTAACTGAAATGGCCGAGAACTCGAGTTCTCGGCCATTTCAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-561s21c1
Sequence:CCGGCAATATGGCCAGGGTTTATAACTCGAGTTATAAACCCTGGCCATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-201s21c1
Sequence:CCGGTGAACAATACCAGAAGTATAACTCGAGTTATACTTCTGGTATTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-423s21c1
Sequence:CCGGGGCTAATGTAATGCTTGAATACTCGAGTATTCAAGCATTACATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-821s1c1
Sequence:CCGGCCTAACTGAAATGGCCGAGAACTCGAGTTCTCGGCCATTTCAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011692.1-519s1c1
Sequence:CCGGGCCAGGGTTTATAATTGGGATCTCGAGATCCCAATTATAAACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-489s1c1
Sequence:CCGGGATCAGTTTACTACCACAGAACTCGAGTTCTGTGGTAGTAAACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-298s1c1
Sequence:CCGGCGAGATTCTTACTGGCCGATACTCGAGTATCGGCCAGTAAGAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-345s1c1
Sequence:CCGGCCTACTGATAAAGTATGCCTACTCGAGTAGGCATACTTTATCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011692
VALIDATED
VBP1 MISSION shRNA shRNA Plasmid DNA
von Hippel-Lindau binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-875s21c1
Sequence:CCGGCCTAACTGAAATGGCCGAGAACTCGAGTTCTCGGCCATTTCAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-561s21c1
Sequence:CCGGCAATATGGCCAGGGTTTATAACTCGAGTTATAAACCCTGGCCATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-201s21c1
Sequence:CCGGTGAACAATACCAGAAGTATAACTCGAGTTATACTTCTGGTATTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-423s21c1
Sequence:CCGGGGCTAATGTAATGCTTGAATACTCGAGTATTCAAGCATTACATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-821s1c1
Sequence:CCGGCCTAACTGAAATGGCCGAGAACTCGAGTTCTCGGCCATTTCAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011692.1-519s1c1
Sequence:CCGGGCCAGGGTTTATAATTGGGATCTCGAGATCCCAATTATAAACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-489s1c1
Sequence:CCGGGATCAGTTTACTACCACAGAACTCGAGTTCTGTGGTAGTAAACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-298s1c1
Sequence:CCGGCGAGATTCTTACTGGCCGATACTCGAGTATCGGCCAGTAAGAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-345s1c1
Sequence:CCGGCCTACTGATAAAGTATGCCTACTCGAGTAGGCATACTTTATCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011692
VALIDATED
VBP1 MISSION shRNA Lentiviral Transduction Particles
von Hippel-Lindau binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335675    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-875s21c1
Sequence:CCGGCCTAACTGAAATGGCCGAGAACTCGAGTTCTCGGCCATTTCAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-561s21c1
Sequence:CCGGCAATATGGCCAGGGTTTATAACTCGAGTTATAAACCCTGGCCATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-201s21c1
Sequence:CCGGTGAACAATACCAGAAGTATAACTCGAGTTATACTTCTGGTATTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011692.2-423s21c1
Sequence:CCGGGGCTAATGTAATGCTTGAATACTCGAGTATTCAAGCATTACATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-821s1c1
Sequence:CCGGCCTAACTGAAATGGCCGAGAACTCGAGTTCTCGGCCATTTCAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011692.1-519s1c1
Sequence:CCGGGCCAGGGTTTATAATTGGGATCTCGAGATCCCAATTATAAACCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-489s1c1
Sequence:CCGGGATCAGTTTACTACCACAGAACTCGAGTTCTGTGGTAGTAAACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-298s1c1
Sequence:CCGGCGAGATTCTTACTGGCCGATACTCGAGTATCGGCCAGTAAGAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011692.1-345s1c1
Sequence:CCGGCCTACTGATAAAGTATGCCTACTCGAGTAGGCATACTTTATCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks