EMAIL THIS PAGE TO A FRIEND

VCAM1

vascular cell adhesion molecule 1

Synonyms: CD106 INCAM-100
UniProtKB ID: P19320, A8K6R7, B4DKS4, E9PDD1, Q6NUP8
Gene ID:
Human(7412) Summary: This gene is a member of the Ig superfamily and encodes a cell surface sialoglycoprotein expressed by cytokine-activated endothelium. This type I membrane protein mediates leukocyte-endothelial cell adhesion and signal transduction, and may play a role in the development of artherosclerosis and rheumatoid arthritis. Three alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2010]
Mouse(22329) vascular cell adhesion molecule 1
Rat(25361) vascular cell adhesion molecule 1
naked mole-rat(101725534) vascular cell adhesion molecule 1
domestic guinea pig(100722681) vascular cell adhesion molecule 1
cow(282118) vascular cell adhesion molecule 1
Zebrafish(561971) vascular cell adhesion molecule 1
chicken(424467) vascular cell adhesion molecule 1
domestic cat(101088865) vascular cell adhesion molecule 1
dog(403982) vascular cell adhesion molecule 1
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305743 ANTI-CD106 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
SAB1406579 Anti-VCAM1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA034796 Anti-VCAM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA069867 Anti-VCAM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4700521 Monoclonal Anti-CD106 antibody produced in mouse clone STA, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB1305520 MONOCLONAL ANTI-CD106 antibody produced in mouse clone 582CT25.6.4, crude ascites, buffered aqueous solution human
western blot pricing
SAB4700522 Monoclonal Anti-CD106-APC antibody produced in mouse clone STA, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700523 Monoclonal Anti-CD106-Biotin antibody produced in mouse clone STA, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700693 Monoclonal Anti-CD106-PE antibody produced in mouse clone STA, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, immunohistochemistry, immunoprecipitation pricing
V9263 Monoclonal Anti-Vascular Cell Adhesion Molecule 1 antibody produced in mouse ~1 mg/mL, clone 1.4C3, purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1402959 Monoclonal Anti-VCAM1 antibody produced in mouse clone 1H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4100447 Monoclonal Anti-VCAM1 antibody produced in mouse clone VCAM1-B382, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001078 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001078 Rosetta Predictions human pricing
NM_080682 Rosetta Predictions human pricing
NM_012889 Rosetta Predictions rat pricing
NM_011693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168142 predicted 358
2 SASI_Hs01_00168145 predicted 667
3 SASI_Hs01_00168146 predicted 591
4 SASI_Hs02_00313256 predicted 2088
5 SASI_Hs02_00313257 predicted 703
6 SASI_Hs01_00168148 predicted 2004
7 SASI_Hs01_00168149 predicted 2346
8 SASI_Hs01_00168151 predicted 647
9 SASI_Hs02_00313258 predicted 2429
10 SASI_Hs02_00313259 predicted 2372
11 SASI_Hs01_00168143 predicted 412
12 SASI_Hs01_00168144 predicted 657
13 SASI_Hs01_00168147 predicted 1898
14 SASI_Hs01_00168150 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163255 predicted 354
2 SASI_Hs01_00163258 predicted 670
3 SASI_Hs01_00163259 predicted 591
4 SASI_Hs02_00362461 predicted 1816
5 SASI_Hs02_00362462 predicted 703
6 SASI_Hs01_00163261 predicted 1727
7 SASI_Hs01_00163262 predicted 2062
8 SASI_Hs01_00163264 predicted 650
9 SASI_Hs02_00362463 predicted 2153
10 SASI_Hs02_00362464 predicted 2103
11 SASI_Hs01_00163256 predicted 420
12 SASI_Hs01_00163257 predicted 664
13 SASI_Hs01_00163260 predicted 1622
14 SASI_Hs01_00163263 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066469 predicted 238
2 SASI_Rn01_00066470 predicted 396
3 SASI_Rn01_00066471 predicted 1941
4 SASI_Rn01_00066473 predicted 250
5 SASI_Rn02_00260406 predicted 378
6 SASI_Rn01_00066474 predicted 2158
7 SASI_Rn01_00066475 predicted 1522
8 SASI_Rn01_00066476 predicted 475
9 SASI_Rn02_00260407 predicted 1827
10 SASI_Rn02_00260408 predicted 311
11 SASI_Rn01_00066468 predicted 1874
12 SASI_Rn01_00066472 predicted 1888
13 SASI_Rn01_00066477 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321246 predicted 2053
2 SASI_Mm01_00164805 predicted 733
3 SASI_Mm01_00164807 predicted 790
4 SASI_Mm02_00321247 predicted 2632
5 SASI_Mm02_00321248 predicted 844
6 SASI_Mm02_00321249 predicted 977
7 SASI_Mm01_00164809 predicted 907
8 SASI_Mm01_00164810 predicted 667
9 SASI_Mm01_00164811 predicted 826
10 SASI_Mm01_00164812 predicted 2194
11 SASI_Mm01_00164806 predicted 2364
12 SASI_Mm01_00164808 predicted 1821
13 SASI_Mm01_00164813 predicted 918
14 SASI_Mm01_00164814 predicted 1661
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011693
VCAM1 MISSION shRNA Bacterial Glycerol Stock
vascular cell adhesion molecule 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011693.2-2584s1c1
Sequence:CCGGCCAGATCCTTAATACTGTTTACTCGAGTAAACAGTATTAAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-1615s1c1
Sequence:CCGGCCCTTTGACCATCTGGAGATTCTCGAGAATCTCCAGATGGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-927s1c1
Sequence:CCGGCCAAATTGATTCTACACTCAACTCGAGTTGAGTGTAGAATCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-2070s1c1
Sequence:CCGGCGAGGCTGGAATTAGCAGAAACTCGAGTTTCTGCTAATTCCAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-504s1c1
Sequence:CCGGCCAGATAGACAGCCCACTAAACTCGAGTTTAGTGGGCTGTCTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011693
VCAM1 MISSION shRNA shRNA Plasmid DNA
vascular cell adhesion molecule 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011693.2-2584s1c1
Sequence:CCGGCCAGATCCTTAATACTGTTTACTCGAGTAAACAGTATTAAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-1615s1c1
Sequence:CCGGCCCTTTGACCATCTGGAGATTCTCGAGAATCTCCAGATGGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-927s1c1
Sequence:CCGGCCAAATTGATTCTACACTCAACTCGAGTTGAGTGTAGAATCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-2070s1c1
Sequence:CCGGCGAGGCTGGAATTAGCAGAAACTCGAGTTTCTGCTAATTCCAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-504s1c1
Sequence:CCGGCCAGATAGACAGCCCACTAAACTCGAGTTTAGTGGGCTGTCTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011693
VCAM1 MISSION shRNA Lentiviral Transduction Particles
vascular cell adhesion molecule 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094139    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011693.2-2584s1c1
Sequence:CCGGCCAGATCCTTAATACTGTTTACTCGAGTAAACAGTATTAAGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-1615s1c1
Sequence:CCGGCCCTTTGACCATCTGGAGATTCTCGAGAATCTCCAGATGGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-927s1c1
Sequence:CCGGCCAAATTGATTCTACACTCAACTCGAGTTGAGTGTAGAATCAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-2070s1c1
Sequence:CCGGCGAGGCTGGAATTAGCAGAAACTCGAGTTTCTGCTAATTCCAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011693.2-504s1c1
Sequence:CCGGCCAGATAGACAGCCCACTAAACTCGAGTTTAGTGGGCTGTCTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001078
VCAM1 MISSION shRNA Bacterial Glycerol Stock
vascular cell adhesion molecule 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-2108s1c1
Sequence:CCGGCGGGAGTATATGAATGTGAATCTCGAGATTCACATTCATATACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-706s1c1
Sequence:CCGGCGAGCTAAATTACACATTGATCTCGAGATCAATGTGTAATTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-562s1c1
Sequence:CCGGCTGGAGATAGACTTACTGAAACTCGAGTTTCAGTAAGTCTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-303s1c1
Sequence:CCGGCCAGATAGATAGTCCACTGAACTCGAGTTCAGTGGACTATCTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078.2-1800s21c1
Sequence:CCGGGAATGCAACTCTCACCTTAATCTCGAGATTAAGGTGAGAGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078.2-1896s21c1
Sequence:CCGGGGAATTAATTATCCAAGTTACCTCGAGGTAACTTGGATAATTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001078
VCAM1 MISSION shRNA shRNA Plasmid DNA
vascular cell adhesion molecule 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-2108s1c1
Sequence:CCGGCGGGAGTATATGAATGTGAATCTCGAGATTCACATTCATATACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-706s1c1
Sequence:CCGGCGAGCTAAATTACACATTGATCTCGAGATCAATGTGTAATTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-562s1c1
Sequence:CCGGCTGGAGATAGACTTACTGAAACTCGAGTTTCAGTAAGTCTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-303s1c1
Sequence:CCGGCCAGATAGATAGTCCACTGAACTCGAGTTCAGTGGACTATCTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078.2-1800s21c1
Sequence:CCGGGAATGCAACTCTCACCTTAATCTCGAGATTAAGGTGAGAGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078.2-1896s21c1
Sequence:CCGGGGAATTAATTATCCAAGTTACCTCGAGGTAACTTGGATAATTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001078
VCAM1 MISSION shRNA Lentiviral Transduction Particles
vascular cell adhesion molecule 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-2108s1c1
Sequence:CCGGCGGGAGTATATGAATGTGAATCTCGAGATTCACATTCATATACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-706s1c1
Sequence:CCGGCGAGCTAAATTACACATTGATCTCGAGATCAATGTGTAATTTAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-562s1c1
Sequence:CCGGCTGGAGATAGACTTACTGAAACTCGAGTTTCAGTAAGTCTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001078.2-303s1c1
Sequence:CCGGCCAGATAGATAGTCCACTGAACTCGAGTTCAGTGGACTATCTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078.2-1800s21c1
Sequence:CCGGGAATGCAACTCTCACCTTAATCTCGAGATTAAGGTGAGAGTTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001078.2-1896s21c1
Sequence:CCGGGGAATTAATTATCCAAGTTACCTCGAGGTAACTTGGATAATTAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks