EMAIL THIS PAGE TO A FRIEND

VCAN

versican

Synonyms: CSPG2 ERVR GHAP PG-M WGN WGN1
Gene ID:
Human(1462) Summary: This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Mouse(13003) versican
Rat(114122) versican
chicken(395565) versican
dog(488922) versican
cow(282662) versican
sheep(100294605) versican
Gene Class: Calcium_Binding
196 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408906 Anti-VCAN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA004726 Anti-VCAN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
V5639 Anti-Versican V0/V1 Neo antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
SAB5201077 Monoclonal Anti-Versican - Alkaline Phosphatase antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201078 Monoclonal Anti-Versican - Apc antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201069 Monoclonal Anti-Versican - Atto 390 antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201070 Monoclonal Anti-Versican - Atto 488 antibody produced in mouse clone S351-23, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201071 Monoclonal Anti-Versican - Atto 565 antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201072 Monoclonal Anti-Versican - Atto 594 antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201073 Monoclonal Anti-Versican - Atto 633 antibody produced in mouse clone S351-23, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201074 Monoclonal Anti-Versican - Atto 655 antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201075 Monoclonal Anti-Versican - Atto 680 antibody produced in mouse clone S351-23, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201076 Monoclonal Anti-Versican - Atto 700 antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201079 Monoclonal Anti-Versican - Biotin antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201080 Monoclonal Anti-Versican - Fitc antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201081 Monoclonal Anti-Versican - Hrp antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201082 Monoclonal Anti-Versican - Pe/Atto 594 antibody produced in mouse clone S351-23, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201083 Monoclonal Anti-Versican - Percp antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201084 Monoclonal Anti-Versican - Rpe antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing
SAB5201085 Monoclonal Anti-Versican - Streptavidin antibody produced in mouse clone S351-23, purified immunoglobulin rat, mouse
immunocytochemistry, western blot pricing
SAB5201068 Monoclonal Anti-Versican antibody produced in mouse clone S351-23, purified immunoglobulin mouse, rat
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004385 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019389 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019389 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019389 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126336 Rosetta Predictions human pricing
NM_004385 Rosetta Predictions human pricing
XM_001058160 Rosetta Predictions rat pricing
XM_001058357 Rosetta Predictions rat pricing
XM_215451 Rosetta Predictions rat pricing
NM_001081249 Rosetta Predictions mouse pricing
XM_488510 Rosetta Predictions mouse pricing
XM_898908 Rosetta Predictions mouse pricing
XM_898918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328457 predicted 2032
2 SASI_Hs02_00328458 predicted 464
3 SASI_Hs02_00328459 predicted 504
4 SASI_Hs02_00328460 predicted 2202
5 SASI_Hs02_00328461 predicted 1930
6 SASI_Hs02_00328462 predicted 343
7 SASI_Hs02_00328463 predicted 727
8 SASI_Hs02_00328464 predicted 2053
9 SASI_Hs02_00328465 predicted 689
10 SASI_Hs02_00328466 predicted 2142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337484 predicted 10261
2 SASI_Hs02_00337485 predicted 459
3 SASI_Hs02_00337486 predicted 505
4 SASI_Hs02_00337487 predicted 10433
5 SASI_Hs02_00337488 predicted 10160
6 SASI_Hs02_00337489 predicted 348
7 SASI_Hs02_00337490 predicted 732
8 SASI_Hs02_00337491 predicted 10274
9 SASI_Hs02_00337492 predicted 688
10 SASI_Hs02_00337493 predicted 10370
11 SASI_Hs01_00130471 predicted 2141
12 SASI_Hs01_00130472 predicted 5450
13 SASI_Hs01_00130473 predicted 6185
14 SASI_Hs01_00130474 predicted 1315
15 SASI_Hs01_00130475 predicted 8361
16 SASI_Hs01_00130476 predicted 2561
17 SASI_Hs01_00130477 predicted 8479
18 SASI_Hs01_00130478 predicted 3496
19 SASI_Hs01_00130479 predicted 6464
20 SASI_Hs01_00130480 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288795 predicted 1660
2 SASI_Rn02_00288796 predicted 2198
3 SASI_Rn02_00288797 predicted 793
4 SASI_Rn02_00288798 predicted 1779
5 SASI_Rn02_00288799 predicted 2385
6 SASI_Rn02_00288800 predicted 2108
7 SASI_Rn02_00288801 predicted 2323
8 SASI_Rn02_00288802 predicted 1104
9 SASI_Rn02_00288803 predicted 764
10 SASI_Rn02_00288804 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289401 predicted 9714
2 SASI_Rn02_00289402 predicted 5103
3 SASI_Rn02_00289403 predicted 7237
4 SASI_Rn02_00289404 predicted 741
5 SASI_Rn02_00289405 predicted 8146
6 SASI_Rn02_00289406 predicted 8537
7 SASI_Rn02_00289407 predicted 2435
8 SASI_Rn02_00289408 predicted 2917
9 SASI_Rn02_00289409 predicted 10446
10 SASI_Rn02_00289410 predicted 8611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376005 predicted 9469
2 SASI_Rn02_00376006 predicted 9050
3 SASI_Rn02_00376007 predicted 9657
4 SASI_Rn02_00376008 predicted 9625
5 SASI_Rn02_00376009 predicted 9380
6 SASI_Rn02_00376010 predicted 9592
7 SASI_Rn02_00376011 predicted 9481
8 SASI_Rn02_00376012 predicted 9076
9 SASI_Rn02_00376013 predicted 9661
10 SASI_Rn02_00376014 predicted 9054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296627 predicted 585
2 SASI_Mm02_00296628 predicted 2046
3 SASI_Mm02_00296629 predicted 9707
4 SASI_Mm02_00296630 predicted 7229
5 SASI_Mm02_00296631 predicted 602
6 SASI_Mm02_00296632 predicted 2285
7 SASI_Mm02_00296633 predicted 6866
8 SASI_Mm02_00296634 predicted 8610
9 SASI_Mm02_00296635 predicted 2683
10 SASI_Mm02_00296636 predicted 6386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_488510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250476 predicted 9827
2 SASI_Mm01_00250477 predicted 10157
3 SASI_Mm01_00250478 predicted 1056
4 SASI_Mm01_00250479 predicted 9943
5 SASI_Mm01_00250480 predicted 1162
6 SASI_Mm01_00250481 predicted 10258
7 SASI_Mm01_00250482 predicted 10261
8 SASI_Mm01_00250483 predicted 10102
9 SASI_Mm01_00250484 predicted 9864
10 SASI_Mm01_00250485 predicted 10245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263512 predicted 978
2 SASI_Mm01_00263513 predicted 1974
3 SASI_Mm01_00263514 predicted 858
4 SASI_Mm01_00263515 predicted 1980
5 SASI_Mm01_00263516 predicted 838
6 SASI_Mm01_00263517 predicted 982
7 SASI_Mm01_00263518 predicted 1965
8 SASI_Mm01_00263519 predicted 1069
9 SASI_Mm01_00263520 predicted 894
10 SASI_Mm01_00263521 predicted 1974
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285125 predicted 7008
2 SASI_Mm01_00285126 predicted 7340
3 SASI_Mm01_00285127 predicted 1109
4 SASI_Mm01_00285128 predicted 7114
5 SASI_Mm01_00285129 predicted 1213
6 SASI_Mm01_00285130 predicted 7442
7 SASI_Mm01_00285131 predicted 7442
8 SASI_Mm01_00285132 predicted 7280
9 SASI_Mm01_00285133 predicted 7035
10 SASI_Mm01_00285134 predicted 7431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004385
VALIDATED
VCAN MISSION shRNA Bacterial Glycerol Stock
versican
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.3-3854s21c1
Sequence:CCGGGATTTAGGCTCAGGATTATTTCTCGAGAAATAATCCTGAGCCTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.3-10899s21c1
Sequence:CCGGACAATGAGTTTGGGCATATTTCTCGAGAAATATGCCCAAACTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.3-5312s21c1
Sequence:CCGGACTGATACACTCATTACTTTACTCGAGTAAAGTAATGAGTGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.3-3347s21c1
Sequence:CCGGACTCGCCTTGAAGCGACTATTCTCGAGAATAGTCGCTTCAAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.3-346s21c1
Sequence:CCGGATGGATGTGTTCAACCTTAATCTCGAGATTAAGGTTGAACACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004385.4-10937s21c1
Sequence:CCGGCAATGAGTTTGGGCATATTTACTCGAGTAAATATGCCCAAACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.4-2354s21c1
Sequence:CCGGGGGAATTTCCACAGTTATTTACTCGAGTAAATAACTGTGGAAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.4-532s21c1
Sequence:CCGGGTGAATTTCTCCGCATCAAATCTCGAGATTTGATGCGGAGAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.4-1421s21c1
Sequence:CCGGTTTGAGTATCCTCGCAGAAACCTCGAGGTTTCTGCGAGGATACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004385.2-4084s1c1
Sequence:CCGGCCGATATTGATAGAGAGTATTCTCGAGAATACTCTCTATCAATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004385.2-452s1c1
Sequence:CCGGCCGCATCAAATGGTCTAAGATCTCGAGATCTTAGACCATTTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004385.2-9571s1c1
Sequence:CCGGGCACCTGTTATCCTACTGAAACTCGAGTTTCAGTAGGATAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004385.2-2918s1c1
Sequence:CCGGGCCAACTACATCAACTGGTATCTCGAGATACCAGTTGATGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004385.2-8364s1c1
Sequence:CCGGGCCACAGTTATTCCAGAGATTCTCGAGAATCTCTGGAATAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004385
VALIDATED
VCAN MISSION shRNA shRNA Plasmid DNA
versican
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.3-3854s21c1
Sequence:CCGGGATTTAGGCTCAGGATTATTTCTCGAGAAATAATCCTGAGCCTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.3-10899s21c1
Sequence:CCGGACAATGAGTTTGGGCATATTTCTCGAGAAATATGCCCAAACTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.3-5312s21c1
Sequence:CCGGACTGATACACTCATTACTTTACTCGAGTAAAGTAATGAGTGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.3-3347s21c1
Sequence:CCGGACTCGCCTTGAAGCGACTATTCTCGAGAATAGTCGCTTCAAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.3-346s21c1
Sequence:CCGGATGGATGTGTTCAACCTTAATCTCGAGATTAAGGTTGAACACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004385.4-10937s21c1
Sequence:CCGGCAATGAGTTTGGGCATATTTACTCGAGTAAATATGCCCAAACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.4-2354s21c1
Sequence:CCGGGGGAATTTCCACAGTTATTTACTCGAGTAAATAACTGTGGAAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.4-532s21c1
Sequence:CCGGGTGAATTTCTCCGCATCAAATCTCGAGATTTGATGCGGAGAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.4-1421s21c1
Sequence:CCGGTTTGAGTATCCTCGCAGAAACCTCGAGGTTTCTGCGAGGATACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004385.2-4084s1c1
Sequence:CCGGCCGATATTGATAGAGAGTATTCTCGAGAATACTCTCTATCAATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004385.2-452s1c1
Sequence:CCGGCCGCATCAAATGGTCTAAGATCTCGAGATCTTAGACCATTTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004385.2-9571s1c1
Sequence:CCGGGCACCTGTTATCCTACTGAAACTCGAGTTTCAGTAGGATAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004385.2-2918s1c1
Sequence:CCGGGCCAACTACATCAACTGGTATCTCGAGATACCAGTTGATGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004385.2-8364s1c1
Sequence:CCGGGCCACAGTTATTCCAGAGATTCTCGAGAATCTCTGGAATAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004385
VALIDATED
VCAN MISSION shRNA Lentiviral Transduction Particles
versican
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.3-3854s21c1
Sequence:CCGGGATTTAGGCTCAGGATTATTTCTCGAGAAATAATCCTGAGCCTAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.3-10899s21c1
Sequence:CCGGACAATGAGTTTGGGCATATTTCTCGAGAAATATGCCCAAACTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.3-5312s21c1
Sequence:CCGGACTGATACACTCATTACTTTACTCGAGTAAAGTAATGAGTGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.3-3347s21c1
Sequence:CCGGACTCGCCTTGAAGCGACTATTCTCGAGAATAGTCGCTTCAAGGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.3-346s21c1
Sequence:CCGGATGGATGTGTTCAACCTTAATCTCGAGATTAAGGTTGAACACATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004385.4-10937s21c1
Sequence:CCGGCAATGAGTTTGGGCATATTTACTCGAGTAAATATGCCCAAACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.4-2354s21c1
Sequence:CCGGGGGAATTTCCACAGTTATTTACTCGAGTAAATAACTGTGGAAATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004385.4-532s21c1
Sequence:CCGGGTGAATTTCTCCGCATCAAATCTCGAGATTTGATGCGGAGAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004385.4-1421s21c1
Sequence:CCGGTTTGAGTATCCTCGCAGAAACCTCGAGGTTTCTGCGAGGATACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004385.2-4084s1c1
Sequence:CCGGCCGATATTGATAGAGAGTATTCTCGAGAATACTCTCTATCAATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004385.2-452s1c1
Sequence:CCGGCCGCATCAAATGGTCTAAGATCTCGAGATCTTAGACCATTTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004385.2-9571s1c1
Sequence:CCGGGCACCTGTTATCCTACTGAAACTCGAGTTTCAGTAGGATAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004385.2-2918s1c1
Sequence:CCGGGCCAACTACATCAACTGGTATCTCGAGATACCAGTTGATGTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004385.2-8364s1c1
Sequence:CCGGGCCACAGTTATTCCAGAGATTCTCGAGAATCTCTGGAATAACTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081249
VALIDATED
VCAN MISSION shRNA Bacterial Glycerol Stock
versican
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081249.1-3320s1c1
Sequence:CCGGCACTACTTATGTAGACATATCCTCGAGGATATGTCTACATAAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_001081249.1-4748s1c1
Sequence:CCGGGTCAACTACCATGCAATTTAACTCGAGTTAAATTGCATGGTAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081249.1-4369s1c1
Sequence:CCGGGTCGATTGAGTGATATGATTGCTCGAGCAATCATATCACTCAATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_001081249.1-475s1c1
Sequence:CCGGGGATGTGCTCAACCTTATTACCTCGAGGTAATAAGGTTGAGCACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-11481s21c1
Sequence:CCGGACTGCGGAGCACACGTAAATACTCGAGTATTTACGTGTGCTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-698s21c1
Sequence:CCGGGGTGGCCCAGAACGGAAATATCTCGAGATATTTCCGTTCTGGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-8459s21c1
Sequence:CCGGAGCTAGTCCGGAGATTGATAACTCGAGTTATCAATCTCCGGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-8701s21c1
Sequence:CCGGTTGGTAGTACATACCTTATAGCTCGAGCTATAAGGTATGTACTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-1609s21c1
Sequence:CCGGTAGCCACCGAATTACCTATTTCTCGAGAAATAGGTAATTCGGTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081249
VALIDATED
VCAN MISSION shRNA shRNA Plasmid DNA
versican
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081249.1-3320s1c1
Sequence:CCGGCACTACTTATGTAGACATATCCTCGAGGATATGTCTACATAAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_001081249.1-4748s1c1
Sequence:CCGGGTCAACTACCATGCAATTTAACTCGAGTTAAATTGCATGGTAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081249.1-4369s1c1
Sequence:CCGGGTCGATTGAGTGATATGATTGCTCGAGCAATCATATCACTCAATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_001081249.1-475s1c1
Sequence:CCGGGGATGTGCTCAACCTTATTACCTCGAGGTAATAAGGTTGAGCACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-11481s21c1
Sequence:CCGGACTGCGGAGCACACGTAAATACTCGAGTATTTACGTGTGCTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-698s21c1
Sequence:CCGGGGTGGCCCAGAACGGAAATATCTCGAGATATTTCCGTTCTGGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-8459s21c1
Sequence:CCGGAGCTAGTCCGGAGATTGATAACTCGAGTTATCAATCTCCGGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-8701s21c1
Sequence:CCGGTTGGTAGTACATACCTTATAGCTCGAGCTATAAGGTATGTACTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-1609s21c1
Sequence:CCGGTAGCCACCGAATTACCTATTTCTCGAGAAATAGGTAATTCGGTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081249
VALIDATED
VCAN MISSION shRNA Lentiviral Transduction Particles
versican
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081249.1-3320s1c1
Sequence:CCGGCACTACTTATGTAGACATATCCTCGAGGATATGTCTACATAAGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_001081249.1-4748s1c1
Sequence:CCGGGTCAACTACCATGCAATTTAACTCGAGTTAAATTGCATGGTAGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081249.1-4369s1c1
Sequence:CCGGGTCGATTGAGTGATATGATTGCTCGAGCAATCATATCACTCAATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_001081249.1-475s1c1
Sequence:CCGGGGATGTGCTCAACCTTATTACCTCGAGGTAATAAGGTTGAGCACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240556    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-11481s21c1
Sequence:CCGGACTGCGGAGCACACGTAAATACTCGAGTATTTACGTGTGCTCCGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-698s21c1
Sequence:CCGGGGTGGCCCAGAACGGAAATATCTCGAGATATTTCCGTTCTGGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-8459s21c1
Sequence:CCGGAGCTAGTCCGGAGATTGATAACTCGAGTTATCAATCTCCGGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-8701s21c1
Sequence:CCGGTTGGTAGTACATACCTTATAGCTCGAGCTATAAGGTATGTACTACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081249.1-1609s21c1
Sequence:CCGGTAGCCACCGAATTACCTATTTCTCGAGAAATAGGTAATTCGGTGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019389
VALIDATED
VCAN MISSION shRNA Bacterial Glycerol Stock
versican
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000193654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019389.1-3372s1c1
Sequence:CCGGCGGAAGAGAAACAGTGACAAACTCGAGTTTGTCACTGTTTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_019389.1-2459s1c1
Sequence:CCGGCCTTTGAGCATAGCAGTAGTACTCGAGTACTACTGCTATGCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019389.1-7223s1c1
Sequence:CCGGCTTCACTCATCATTTCAGCCACTCGAGTGGCTGAAATGATGAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019389
VALIDATED
VCAN MISSION shRNA shRNA Plasmid DNA
versican
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000193654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019389.1-3372s1c1
Sequence:CCGGCGGAAGAGAAACAGTGACAAACTCGAGTTTGTCACTGTTTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_019389.1-2459s1c1
Sequence:CCGGCCTTTGAGCATAGCAGTAGTACTCGAGTACTACTGCTATGCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019389.1-7223s1c1
Sequence:CCGGCTTCACTCATCATTTCAGCCACTCGAGTGGCTGAAATGATGAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019389
VALIDATED
VCAN MISSION shRNA Lentiviral Transduction Particles
versican
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000193654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019389.1-3372s1c1
Sequence:CCGGCGGAAGAGAAACAGTGACAAACTCGAGTTTGTCACTGTTTCTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_019389.1-2459s1c1
Sequence:CCGGCCTTTGAGCATAGCAGTAGTACTCGAGTACTACTGCTATGCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175477    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019389.1-7223s1c1
Sequence:CCGGCTTCACTCATCATTTCAGCCACTCGAGTGGCTGAAATGATGAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks