EMAIL THIS PAGE TO A FRIEND

VCL

vinculin

Synonyms: CMD1W CMH15 MV MVCL
UniProtKB ID: P18206, Q16450, Q5SWX2, Q7Z3B8, Q8IXU7
Gene ID:
Human(7414) Summary: Vinculin is a cytoskeletal protein associated with cell-cell and cell-matrix junctions, where it is thought to function as one of several interacting proteins involved in anchoring F-actin to the membrane. Defects in VCL are the cause of cardiomyopathy dilated type 1W. Dilated cardiomyopathy is a disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(22330) vinculin
Rat(305679) vinculin
Horse(100064165) vinculin
dog(479252) vinculin
chicken(396422) vinculin
cow(783645) vinculin
sheep(101121312) vinculin
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504217 Anti-phospho-Vinculin (pTyr821) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4301470 Anti-phospho-Vinculin (pTyr821) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
V4889 Anti-phospho-Vinculin (pTyr822) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, chicken, rat
western blot pricing
HPA002131 Anti-VCL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
HPA063777 Anti-VCL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB1305343 ANTI-VINC(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing
SAB1305406 ANTI-VINC(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
V4139 Anti-Vinculin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, western blot pricing
SAB4503069 Anti-Vinculin antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
V9264 Anti-Vinculin antibody, Mouse monoclonal clone hVIN-1, purified from hybridoma cell culture canine, mouse, chicken, frog, rat, bovine, human, turkey
ELISA, immunocytochemistry, immunohistochemistry, western blot pricing
SAB5500192 Anti-Vinculin antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP117, affinity isolated antibody human (tested)
immunohistochemistry pricing
F7053 Anti-Vinculin−FITC antibody, Mouse monoclonal clone hVIN-1, purified from hybridoma cell culture canine, mouse, chicken, frog, rat, bovine, human, turkey
immunofluorescence pricing
SAB1404522 Monoclonal Anti-VCL antibody produced in mouse clone 3F8-1D4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4200080 Monoclonal Anti-Vinculin antibody produced in mouse clone V284, purified immunoglobulin, buffered aqueous solution mouse, canine, rabbit, chicken, human, rat, monkey
immunocytochemistry, immunoprecipitation, western blot pricing
V4505 Monoclonal Anti-Vinculin antibody produced in mouse clone VIN-11-5, ascites fluid bovine, mouse, chicken, human
immunofluorescence, microarray, western blot pricing
V9131 Monoclonal Anti-Vinculin antibody produced in mouse clone hVIN-1, ascites fluid canine, mouse, chicken, frog, rat, bovine, human, turkey
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003373 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003373 Rosetta Predictions human pricing
NM_014000 Rosetta Predictions human pricing
NM_001107248 Rosetta Predictions rat pricing
NM_009502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335533 predicted 2069
2 SASI_Hs01_00057503 predicted 751
3 SASI_Hs01_00057504 predicted 603
4 SASI_Hs01_00057505 predicted 308
5 SASI_Hs01_00057506 predicted 3061
6 SASI_Hs01_00057507 predicted 1261
7 SASI_Hs01_00057508 predicted 3243
8 SASI_Hs02_00335534 predicted 2317
9 SASI_Hs01_00057509 predicted 2127
10 SASI_Hs01_00057511 predicted 1308
11 SASI_Hs01_00057510 predicted 1349
12 SASI_Hs01_00057512 predicted 1947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344967 predicted 2065
2 SASI_Hs01_00189878 predicted 749
3 SASI_Hs01_00189879 predicted 604
4 SASI_Hs01_00189880 predicted 305
5 SASI_Hs01_00189881 predicted 3262
6 SASI_Hs01_00189882 predicted 1263
7 SASI_Hs01_00189883 predicted 3454
8 SASI_Hs02_00344968 predicted 2316
9 SASI_Hs01_00189884 predicted 2126
10 SASI_Hs01_00189886 predicted 1305
11 SASI_Hs01_00189885 predicted 1350
12 SASI_Hs01_00189887 predicted 1951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226965 predicted 3004
2 SASI_Rn02_00226966 predicted 2589
3 SASI_Rn02_00226967 predicted 815
4 SASI_Rn02_00226968 predicted 298
5 SASI_Rn02_00226969 predicted 1937
6 SASI_Rn02_00226970 predicted 2919
7 SASI_Rn02_00226971 predicted 545
8 SASI_Rn02_00226972 predicted 2626
9 SASI_Rn02_00226973 predicted 1860
10 SASI_Rn02_00226974 predicted 2999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063235 predicted 3242
2 SASI_Mm01_00063236 predicted 1816
3 SASI_Mm01_00063237 predicted 1851
4 SASI_Mm01_00063238 predicted 1696
5 SASI_Mm01_00063239 predicted 1937
6 SASI_Mm01_00063240 predicted 2746
7 SASI_Mm01_00063241 predicted 2138
8 SASI_Mm01_00063242 predicted 3292
9 SASI_Mm01_00063243 predicted 298
10 SASI_Mm01_00063244 predicted 1898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009502
VALIDATED
VCL MISSION shRNA Bacterial Glycerol Stock
vinculin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009502.3-3466s1c1
Sequence:CCGGCCCTGTACTTTCAGTTACTATCTCGAGATAGTAACTGAAAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009502.3-3154s1c1
Sequence:CCGGGCTGGTTCATAATGCCCAGAACTCGAGTTCTGGGCATTATGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009502.3-1888s1c1
Sequence:CCGGCGATACTACAACTCCTATCAACTCGAGTTGATAGGAGTTGTAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009502.3-314s1c1
Sequence:CCGGCCAGCCTTTATTAAGGTTGAACTCGAGTTCAACCTTAATAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009502.3-1331s1c1
Sequence:CCGGGCTCGGAAGATTGCAGAATTACTCGAGTAATTCTGCAATCTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009502.4-146s21c1
Sequence:CCGGATCTCGCACCTGGTGATTATGCTCGAGCATAATCACCAGGTGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009502.4-1331s21c1
Sequence:CCGGGCTCGGAAGATTGCAGAATTACTCGAGTAATTCTGCAATCTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009502.4-3466s21c1
Sequence:CCGGCCCTGTACTTTCAGTTACTATCTCGAGATAGTAACTGAAAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009502.4-3042s21c1
Sequence:CCGGGCGAGCGAATCCCAACTATAACTCGAGTTATAGTTGGGATTCGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009502.4-2803s21c1
Sequence:CCGGCCACGATGAAGCTCGGAAATGCTCGAGCATTTCCGAGCTTCATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009502
VALIDATED
VCL MISSION shRNA shRNA Plasmid DNA
vinculin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009502.3-3466s1c1
Sequence:CCGGCCCTGTACTTTCAGTTACTATCTCGAGATAGTAACTGAAAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009502.3-3154s1c1
Sequence:CCGGGCTGGTTCATAATGCCCAGAACTCGAGTTCTGGGCATTATGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009502.3-1888s1c1
Sequence:CCGGCGATACTACAACTCCTATCAACTCGAGTTGATAGGAGTTGTAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009502.3-314s1c1
Sequence:CCGGCCAGCCTTTATTAAGGTTGAACTCGAGTTCAACCTTAATAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009502.3-1331s1c1
Sequence:CCGGGCTCGGAAGATTGCAGAATTACTCGAGTAATTCTGCAATCTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009502.4-146s21c1
Sequence:CCGGATCTCGCACCTGGTGATTATGCTCGAGCATAATCACCAGGTGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009502.4-1331s21c1
Sequence:CCGGGCTCGGAAGATTGCAGAATTACTCGAGTAATTCTGCAATCTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009502.4-3466s21c1
Sequence:CCGGCCCTGTACTTTCAGTTACTATCTCGAGATAGTAACTGAAAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009502.4-3042s21c1
Sequence:CCGGGCGAGCGAATCCCAACTATAACTCGAGTTATAGTTGGGATTCGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009502.4-2803s21c1
Sequence:CCGGCCACGATGAAGCTCGGAAATGCTCGAGCATTTCCGAGCTTCATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009502
VALIDATED
VCL MISSION shRNA Lentiviral Transduction Particles
vinculin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009502.3-3466s1c1
Sequence:CCGGCCCTGTACTTTCAGTTACTATCTCGAGATAGTAACTGAAAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009502.3-3154s1c1
Sequence:CCGGGCTGGTTCATAATGCCCAGAACTCGAGTTCTGGGCATTATGAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009502.3-1888s1c1
Sequence:CCGGCGATACTACAACTCCTATCAACTCGAGTTGATAGGAGTTGTAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009502.3-314s1c1
Sequence:CCGGCCAGCCTTTATTAAGGTTGAACTCGAGTTCAACCTTAATAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009502.3-1331s1c1
Sequence:CCGGGCTCGGAAGATTGCAGAATTACTCGAGTAATTCTGCAATCTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009502.4-146s21c1
Sequence:CCGGATCTCGCACCTGGTGATTATGCTCGAGCATAATCACCAGGTGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009502.4-1331s21c1
Sequence:CCGGGCTCGGAAGATTGCAGAATTACTCGAGTAATTCTGCAATCTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288326    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009502.4-3466s21c1
Sequence:CCGGCCCTGTACTTTCAGTTACTATCTCGAGATAGTAACTGAAAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009502.4-3042s21c1
Sequence:CCGGGCGAGCGAATCCCAACTATAACTCGAGTTATAGTTGGGATTCGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009502.4-2803s21c1
Sequence:CCGGCCACGATGAAGCTCGGAAATGCTCGAGCATTTCCGAGCTTCATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003373
VALIDATED
VCL MISSION shRNA Bacterial Glycerol Stock
vinculin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-3704s1c1
Sequence:CCGGCCCAGGCAAATCAGTTACTAACTCGAGTTAGTAACTGATTTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-3009s1c1
Sequence:CCGGGCACAGATAAACGGATTAGAACTCGAGTTCTAATCCGTTTATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-2149s1c1
Sequence:CCGGCCCTGGAAATCAAGCTGCTTACTCGAGTAAGCAGCTTGATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-2040s1c1
Sequence:CCGGCGGTTGGTACTGCTAATAAATCTCGAGATTTATTAGCAGTACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-404s1c1
Sequence:CCGGGCTCGAGATTATCTAATTGATCTCGAGATCAATTAGATAATCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003373.3-3704s21c1
Sequence:CCGGCCCAGGCAAATCAGTTACTAACTCGAGTTAGTAACTGATTTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-2149s21c1
Sequence:CCGGCCCTGGAAATCAAGCTGCTTACTCGAGTAAGCAGCTTGATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-3009s21c1
Sequence:CCGGGCACAGATAAACGGATTAGAACTCGAGTTCTAATCCGTTTATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-404s21c1
Sequence:CCGGGCTCGAGATTATCTAATTGATCTCGAGATCAATTAGATAATCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-2040s21c1
Sequence:CCGGCGGTTGGTACTGCTAATAAATCTCGAGATTTATTAGCAGTACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003373
VALIDATED
VCL MISSION shRNA shRNA Plasmid DNA
vinculin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-3704s1c1
Sequence:CCGGCCCAGGCAAATCAGTTACTAACTCGAGTTAGTAACTGATTTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-3009s1c1
Sequence:CCGGGCACAGATAAACGGATTAGAACTCGAGTTCTAATCCGTTTATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-2149s1c1
Sequence:CCGGCCCTGGAAATCAAGCTGCTTACTCGAGTAAGCAGCTTGATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-2040s1c1
Sequence:CCGGCGGTTGGTACTGCTAATAAATCTCGAGATTTATTAGCAGTACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-404s1c1
Sequence:CCGGGCTCGAGATTATCTAATTGATCTCGAGATCAATTAGATAATCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003373.3-3704s21c1
Sequence:CCGGCCCAGGCAAATCAGTTACTAACTCGAGTTAGTAACTGATTTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-2149s21c1
Sequence:CCGGCCCTGGAAATCAAGCTGCTTACTCGAGTAAGCAGCTTGATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-3009s21c1
Sequence:CCGGGCACAGATAAACGGATTAGAACTCGAGTTCTAATCCGTTTATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-404s21c1
Sequence:CCGGGCTCGAGATTATCTAATTGATCTCGAGATCAATTAGATAATCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-2040s21c1
Sequence:CCGGCGGTTGGTACTGCTAATAAATCTCGAGATTTATTAGCAGTACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003373
VALIDATED
VCL MISSION shRNA Lentiviral Transduction Particles
vinculin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-3704s1c1
Sequence:CCGGCCCAGGCAAATCAGTTACTAACTCGAGTTAGTAACTGATTTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-3009s1c1
Sequence:CCGGGCACAGATAAACGGATTAGAACTCGAGTTCTAATCCGTTTATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-2149s1c1
Sequence:CCGGCCCTGGAAATCAAGCTGCTTACTCGAGTAAGCAGCTTGATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-2040s1c1
Sequence:CCGGCGGTTGGTACTGCTAATAAATCTCGAGATTTATTAGCAGTACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003373.3-404s1c1
Sequence:CCGGGCTCGAGATTATCTAATTGATCTCGAGATCAATTAGATAATCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003373.3-3704s21c1
Sequence:CCGGCCCAGGCAAATCAGTTACTAACTCGAGTTAGTAACTGATTTGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-2149s21c1
Sequence:CCGGCCCTGGAAATCAAGCTGCTTACTCGAGTAAGCAGCTTGATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-3009s21c1
Sequence:CCGGGCACAGATAAACGGATTAGAACTCGAGTTCTAATCCGTTTATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-404s21c1
Sequence:CCGGGCTCGAGATTATCTAATTGATCTCGAGATCAATTAGATAATCTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003373.3-2040s21c1
Sequence:CCGGCGGTTGGTACTGCTAATAAATCTCGAGATTTATTAGCAGTACCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks