EMAIL THIS PAGE TO A FRIEND

VCP

valosin containing protein

Synonyms: ALS14 IBMPFD TERA p97
UniProtKB ID: P55072, B2R5T8, Q0V924, Q2TAI5, Q969G7, Q9UCD5
Gene ID:
Human(7415) Summary: The protein encoded by this gene is a member of a family that includes putative ATP-binding proteins involved in vesicle transport and fusion, 26S proteasome function, and assembly of peroxisomes. This protein, as a structural protein, is associated with clathrin, and heat-shock protein Hsc70, to form a complex. It has been implicated in a number of cellular events that are regulated during mitosis, including homotypic membrane fusion, spindle pole body function, and ubiquitin-dependent protein degradation. [provided by RefSeq, Jul 2008]
Mouse(269523) valosin containing protein
Rat(116643) valosin-containing protein
Zebrafish(327197) valosin containing protein
dog(481590) valosin containing protein
domestic cat(101091411) valosin containing protein
chicken(427410) valosin containing protein
domestic guinea pig(100727952) valosin containing protein
Domestic Rabbit(100339785) valosin containing protein
naked mole-rat(101712176) valosin containing protein
cow(507345) valosin containing protein
sheep(101109680) valosin containing protein
Gene Class: ATPase
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007126 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071991 MISSION® esiRNA esiRNA human VCP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007126 Rosetta Predictions human pricing
NM_053864 Rosetta Predictions rat pricing
NM_009503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118726 predicted 768
2 SASI_Hs01_00118728 predicted 2548
3 SASI_Hs02_00343009 predicted 1908
4 SASI_Hs01_00118729 predicted 883
5 SASI_Hs01_00118730 predicted 893
6 SASI_Hs01_00118734 predicted 1904
7 SASI_Hs02_00343010 predicted 1580
8 SASI_Hs02_00343011 predicted 2626
9 SASI_Hs02_00343012 predicted 2782
10 SASI_Hs02_00343013 predicted 2787
11 SASI_Hs01_00118727 predicted 804
12 SASI_Hs01_00118731 predicted 621
13 SASI_Hs01_00118732 predicted 469
14 SASI_Hs01_00118733 predicted 1521
15 SASI_Hs01_00118735 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077338 predicted 627
2 SASI_Rn01_00077339 predicted 434
3 SASI_Rn02_00266738 predicted 1516
4 SASI_Rn01_00077340 predicted 1234
5 SASI_Rn01_00077341 predicted 1400
6 SASI_Rn01_00077342 predicted 454
7 SASI_Rn01_00077343 predicted 1800
8 SASI_Rn02_00266739 predicted 1612
9 SASI_Rn01_00077345 predicted 2268
10 SASI_Rn01_00077346 predicted 1942
11 SASI_Rn01_00077344 predicted 803
12 SASI_Rn01_00077347 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029500 predicted 1383
2 SASI_Mm02_00316277 predicted 1475
3 SASI_Mm01_00029501 predicted 1281
4 SASI_Mm01_00029505 predicted 928
5 SASI_Mm01_00029506 predicted 502
6 SASI_Mm01_00029507 predicted 1983
7 SASI_Mm02_00316278 predicted 1385
8 SASI_Mm02_00316279 predicted 2278
9 SASI_Mm02_00316280 predicted 1980
10 SASI_Mm02_00316281 predicted 2121
11 SASI_Mm01_00029502 predicted 2403
12 SASI_Mm01_00029503 predicted 1462
13 SASI_Mm01_00029504 predicted 677
14 SASI_Mm01_00029508 predicted 850
15 SASI_Mm01_00029509 predicted 1467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007126
VCP MISSION shRNA Bacterial Glycerol Stock
valosin containing protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007126.3-3240s21c1
Sequence:CCGGATATAGAGAGTAGGTTGATTTCTCGAGAAATCAACCTACTCTCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007126.3-451s21c1
Sequence:CCGGACCGTCCCAATCGGTTAATTGCTCGAGCAATTAACCGATTGGGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007126.3-2578s21c1
Sequence:CCGGAGATCCGTCGAGATCACTTTGCTCGAGCAAAGTGATCTCGACGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-245s1c1
Sequence:CCGGCCTATCAACAGCCATTCTCAACTCGAGTTGAGAATGGCTGTTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-528s1c1
Sequence:CCGGCCTGATGTGAAGTACGGCAAACTCGAGTTTGCCGTACTTCACATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-1305s1c1
Sequence:CCGGAGGGAGGTAGATATTGGAATTCTCGAGAATTCCAATATCTACCTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-347s1c1
Sequence:CCGGGATGGATGAATTGCAGTTGTTCTCGAGAACAACTGCAATTCATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-720s1c1
Sequence:CCGGCCTAGCCCTTATTGCATTGTTCTCGAGAACAATGCAATAAGGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007126
VCP MISSION shRNA shRNA Plasmid DNA
valosin containing protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007126.3-3240s21c1
Sequence:CCGGATATAGAGAGTAGGTTGATTTCTCGAGAAATCAACCTACTCTCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007126.3-451s21c1
Sequence:CCGGACCGTCCCAATCGGTTAATTGCTCGAGCAATTAACCGATTGGGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007126.3-2578s21c1
Sequence:CCGGAGATCCGTCGAGATCACTTTGCTCGAGCAAAGTGATCTCGACGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-245s1c1
Sequence:CCGGCCTATCAACAGCCATTCTCAACTCGAGTTGAGAATGGCTGTTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-528s1c1
Sequence:CCGGCCTGATGTGAAGTACGGCAAACTCGAGTTTGCCGTACTTCACATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-1305s1c1
Sequence:CCGGAGGGAGGTAGATATTGGAATTCTCGAGAATTCCAATATCTACCTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-347s1c1
Sequence:CCGGGATGGATGAATTGCAGTTGTTCTCGAGAACAACTGCAATTCATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-720s1c1
Sequence:CCGGCCTAGCCCTTATTGCATTGTTCTCGAGAACAATGCAATAAGGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007126
VCP MISSION shRNA Lentiviral Transduction Particles
valosin containing protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007126.3-3240s21c1
Sequence:CCGGATATAGAGAGTAGGTTGATTTCTCGAGAAATCAACCTACTCTCTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007126.3-451s21c1
Sequence:CCGGACCGTCCCAATCGGTTAATTGCTCGAGCAATTAACCGATTGGGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007126.3-2578s21c1
Sequence:CCGGAGATCCGTCGAGATCACTTTGCTCGAGCAAAGTGATCTCGACGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-245s1c1
Sequence:CCGGCCTATCAACAGCCATTCTCAACTCGAGTTGAGAATGGCTGTTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-528s1c1
Sequence:CCGGCCTGATGTGAAGTACGGCAAACTCGAGTTTGCCGTACTTCACATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-1305s1c1
Sequence:CCGGAGGGAGGTAGATATTGGAATTCTCGAGAATTCCAATATCTACCTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-347s1c1
Sequence:CCGGGATGGATGAATTGCAGTTGTTCTCGAGAACAACTGCAATTCATCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007126.x-720s1c1
Sequence:CCGGCCTAGCCCTTATTGCATTGTTCTCGAGAACAATGCAATAAGGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009503
VALIDATED
VCP MISSION shRNA Bacterial Glycerol Stock
valosin containing protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009503.4-3084s21c1
Sequence:CCGGGTAAAGCATCTATACTCAATGCTCGAGCATTGAGTATAGATGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-762s21c1
Sequence:CCGGCCCATCCGTAAAGGAGATATTCTCGAGAATATCTCCTTTACGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-581s21c1
Sequence:CCGGGAATAGAGTTGTTCGGAATAACTCGAGTTATTCCGAACAACTCTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-2559s21c1
Sequence:CCGGCGACGTTCTGTCAGCGATAATCTCGAGATTATCGCTGACAGAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-2468s21c1
Sequence:CCGGGCAGACAAATCCATCGGCTATCTCGAGATAGCCGATGGATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009503.2-3085s1c1
Sequence:CCGGCCTCAGTTTGCTGGGTGTTTACTCGAGTAAACACCCAGCAAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-2397s1c1
Sequence:CCGGGCAGACAAATCCATCGGCTATCTCGAGATAGCCGATGGATTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-691s1c1
Sequence:CCGGCCCATCCGTAAAGGAGATATTCTCGAGAATATCTCCTTTACGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-1744s1c1
Sequence:CCGGCCTGTGGAACATCCAGACAAACTCGAGTTTGTCTGGATGTTCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-2168s1c1
Sequence:CCGGGCCGTCTAGATCAGCTCATTTCTCGAGAAATGAGCTGATCTAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009503
VALIDATED
VCP MISSION shRNA shRNA Plasmid DNA
valosin containing protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009503.4-3084s21c1
Sequence:CCGGGTAAAGCATCTATACTCAATGCTCGAGCATTGAGTATAGATGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-762s21c1
Sequence:CCGGCCCATCCGTAAAGGAGATATTCTCGAGAATATCTCCTTTACGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-581s21c1
Sequence:CCGGGAATAGAGTTGTTCGGAATAACTCGAGTTATTCCGAACAACTCTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-2559s21c1
Sequence:CCGGCGACGTTCTGTCAGCGATAATCTCGAGATTATCGCTGACAGAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-2468s21c1
Sequence:CCGGGCAGACAAATCCATCGGCTATCTCGAGATAGCCGATGGATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009503.2-3085s1c1
Sequence:CCGGCCTCAGTTTGCTGGGTGTTTACTCGAGTAAACACCCAGCAAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-2397s1c1
Sequence:CCGGGCAGACAAATCCATCGGCTATCTCGAGATAGCCGATGGATTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-691s1c1
Sequence:CCGGCCCATCCGTAAAGGAGATATTCTCGAGAATATCTCCTTTACGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-1744s1c1
Sequence:CCGGCCTGTGGAACATCCAGACAAACTCGAGTTTGTCTGGATGTTCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-2168s1c1
Sequence:CCGGGCCGTCTAGATCAGCTCATTTCTCGAGAAATGAGCTGATCTAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009503
VALIDATED
VCP MISSION shRNA Lentiviral Transduction Particles
valosin containing protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009503.4-3084s21c1
Sequence:CCGGGTAAAGCATCTATACTCAATGCTCGAGCATTGAGTATAGATGCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-762s21c1
Sequence:CCGGCCCATCCGTAAAGGAGATATTCTCGAGAATATCTCCTTTACGGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-581s21c1
Sequence:CCGGGAATAGAGTTGTTCGGAATAACTCGAGTTATTCCGAACAACTCTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-2559s21c1
Sequence:CCGGCGACGTTCTGTCAGCGATAATCTCGAGATTATCGCTGACAGAACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009503.4-2468s21c1
Sequence:CCGGGCAGACAAATCCATCGGCTATCTCGAGATAGCCGATGGATTTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011432    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009503.2-3085s1c1
Sequence:CCGGCCTCAGTTTGCTGGGTGTTTACTCGAGTAAACACCCAGCAAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-2397s1c1
Sequence:CCGGGCAGACAAATCCATCGGCTATCTCGAGATAGCCGATGGATTTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-691s1c1
Sequence:CCGGCCCATCCGTAAAGGAGATATTCTCGAGAATATCTCCTTTACGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-1744s1c1
Sequence:CCGGCCTGTGGAACATCCAGACAAACTCGAGTTTGTCTGGATGTTCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009503.2-2168s1c1
Sequence:CCGGGCCGTCTAGATCAGCTCATTTCTCGAGAAATGAGCTGATCTAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks