EMAIL THIS PAGE TO A FRIEND

VCPIP1

valosin containing protein (p97)/p47 complex interacting protein 1

Synonyms: DUBA3 VCIP135
UniProtKB ID: Q96JH7, Q504T4, Q86T93, Q86W01, Q8N3A9, Q9H5R8
Gene ID:
Mouse(70675) valosin containing protein (p97)/p47 complex interacting protein 1
Rat(286761) valosin containing protein (p97)/p47 complex interacting protein 1
cow(539643) valosin containing protein (p97)/p47 complex interacting protein 1
sheep(101122196) valosin containing protein (p97)/p47 complex interacting protein 1
naked mole-rat(101714013) valosin containing protein (p97)/p47 complex interacting protein 1
Domestic Rabbit(100345320) valosin containing protein (p97)/p47 complex interacting protein 1
domestic guinea pig(100717717) valosin containing protein (p97)/p47 complex interacting protein 1
Zebrafish(570582) valosin containing protein (p97)/p47 complex interacting protein 1
domestic cat(101089918) valosin containing protein (p97)/p47 complex interacting protein 1
Horse(100052090) valosin containing protein (p97)/p47 complex interacting protein 1
dog(486980) valosin containing protein (p97)/p47 complex interacting protein 1
chicken(428359) valosin containing protein (p97)/p47 complex interacting protein 1
265 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025054 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025054 Rosetta Predictions human pricing
NM_176857 Rosetta Predictions rat pricing
NM_173443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357704 predicted 3317
2 SASI_Hs01_00165636 predicted 2966
3 SASI_Hs01_00165637 predicted 1162
4 SASI_Hs01_00165638 predicted 3735
5 SASI_Hs01_00165639 predicted 2190
6 SASI_Hs01_00165640 predicted 2679
7 SASI_Hs01_00165641 predicted 2430
8 SASI_Hs01_00165642 predicted 3219
9 SASI_Hs01_00165643 predicted 3361
10 SASI_Hs01_00165644 predicted 2588
11 SASI_Hs01_00165645 predicted 1150
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032324 predicted 2552
2 SASI_Rn01_00032325 predicted 865
3 SASI_Rn01_00032327 predicted 3247
4 SASI_Rn01_00032328 predicted 2531
5 SASI_Rn01_00032330 predicted 3075
6 SASI_Rn02_00269574 predicted 2403
7 SASI_Rn01_00032332 predicted 667
8 SASI_Rn01_00032333 predicted 1004
9 SASI_Rn02_00269575 predicted 3257
10 SASI_Rn02_00269576 predicted 476
11 SASI_Rn01_00032326 predicted 544
12 SASI_Rn01_00032329 predicted 548
13 SASI_Rn01_00032331 predicted 3700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072324 predicted 1744
2 SASI_Mm01_00072325 predicted 3868
3 SASI_Mm01_00072326 predicted 975
4 SASI_Mm01_00072327 predicted 2840
5 SASI_Mm01_00072328 predicted 582
6 SASI_Mm01_00072330 predicted 3187
7 SASI_Mm01_00072331 predicted 1107
8 SASI_Mm01_00072332 predicted 3324
9 SASI_Mm01_00072333 predicted 2516
10 SASI_Mm02_00345340 predicted 3491
11 SASI_Mm01_00072329 predicted 2644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173443
VALIDATED
VCPIP1 MISSION shRNA Bacterial Glycerol Stock
valosin containing protein (p97)/p47 complex interacting protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-2635s1c1
Sequence:CCGGCCTCCATATTTACAGTGTATTCTCGAGAATACACTGTAAATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-2183s1c1
Sequence:CCGGCGGACGATTACACTCCTGTAACTCGAGTTACAGGAGTGTAATCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-584s1c1
Sequence:CCGGGCAAATTATTGTCGCCAATATCTCGAGATATTGGCGACAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-1312s1c1
Sequence:CCGGCCCATGAATTTGTTACCTAAACTCGAGTTTAGGTAACAAATTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173443.1-3805s1c1
Sequence:CCGGCCTGAAGAGATGGATAGTCAACTCGAGTTGACTATCCATCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173443.2-811s21c1
Sequence:GTACCGGGGATATCAAACGGGCTAATAACTCGAGTTATTAGCCCGTTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173443.2-4272s21c1
Sequence:GTACCGGCAAGGTAGCCGTCCTACATTTCTCGAGAAATGTAGGACGGCTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173443.2-3216s21c1
Sequence:GTACCGGGCCCTTCACATGGGTTATTAACTCGAGTTAATAACCCATGTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173443.2-3872s21c1
Sequence:GTACCGGCCGATGGATCACTCGTGATTTCTCGAGAAATCACGAGTGATCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173443
VALIDATED
VCPIP1 MISSION shRNA shRNA Plasmid DNA
valosin containing protein (p97)/p47 complex interacting protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-2635s1c1
Sequence:CCGGCCTCCATATTTACAGTGTATTCTCGAGAATACACTGTAAATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-2183s1c1
Sequence:CCGGCGGACGATTACACTCCTGTAACTCGAGTTACAGGAGTGTAATCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-584s1c1
Sequence:CCGGGCAAATTATTGTCGCCAATATCTCGAGATATTGGCGACAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-1312s1c1
Sequence:CCGGCCCATGAATTTGTTACCTAAACTCGAGTTTAGGTAACAAATTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173443.1-3805s1c1
Sequence:CCGGCCTGAAGAGATGGATAGTCAACTCGAGTTGACTATCCATCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173443.2-811s21c1
Sequence:GTACCGGGGATATCAAACGGGCTAATAACTCGAGTTATTAGCCCGTTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173443.2-4272s21c1
Sequence:GTACCGGCAAGGTAGCCGTCCTACATTTCTCGAGAAATGTAGGACGGCTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173443.2-3216s21c1
Sequence:GTACCGGGCCCTTCACATGGGTTATTAACTCGAGTTAATAACCCATGTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173443.2-3872s21c1
Sequence:GTACCGGCCGATGGATCACTCGTGATTTCTCGAGAAATCACGAGTGATCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173443
VALIDATED
VCPIP1 MISSION shRNA Lentiviral Transduction Particles
valosin containing protein (p97)/p47 complex interacting protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-2635s1c1
Sequence:CCGGCCTCCATATTTACAGTGTATTCTCGAGAATACACTGTAAATATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-2183s1c1
Sequence:CCGGCGGACGATTACACTCCTGTAACTCGAGTTACAGGAGTGTAATCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-584s1c1
Sequence:CCGGGCAAATTATTGTCGCCAATATCTCGAGATATTGGCGACAATAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173443.1-1312s1c1
Sequence:CCGGCCCATGAATTTGTTACCTAAACTCGAGTTTAGGTAACAAATTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173443.1-3805s1c1
Sequence:CCGGCCTGAAGAGATGGATAGTCAACTCGAGTTGACTATCCATCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173443.2-811s21c1
Sequence:GTACCGGGGATATCAAACGGGCTAATAACTCGAGTTATTAGCCCGTTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173443.2-4272s21c1
Sequence:GTACCGGCAAGGTAGCCGTCCTACATTTCTCGAGAAATGTAGGACGGCTACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173443.2-3216s21c1
Sequence:GTACCGGGCCCTTCACATGGGTTATTAACTCGAGTTAATAACCCATGTGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173443.2-3872s21c1
Sequence:GTACCGGCCGATGGATCACTCGTGATTTCTCGAGAAATCACGAGTGATCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025054
VALIDATED
VCPIP1 MISSION shRNA Bacterial Glycerol Stock
valosin containing protein (p97)/p47 complex interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025054.3-7090s1c1
Sequence:CCGGCCTCACTAATAACTAACCTTTCTCGAGAAAGGTTAGTTATTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-2239s1c1
Sequence:CCGGCGATGATTATACTCCTGTAAACTCGAGTTTACAGGAGTATAATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-1160s1c1
Sequence:CCGGCGTCCTATTATTCTGTTAGATCTCGAGATCTAACAGAATAATAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-2238s1c1
Sequence:CCGGCCGATGATTATACTCCTGTAACTCGAGTTACAGGAGTATAATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-1305s1c1
Sequence:CCGGGCTCCGGTAGAAACCATTATACTCGAGTATAATGGTTTCTACCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_025054.4-1395s21c1
Sequence:CCGGGTGTGCCTCAGGACCTTATTACTCGAGTAATAAGGTCCTGAGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025054.4-7944s21c1
Sequence:CCGGCTCGTCCTGAGCCCTTATTATCTCGAGATAATAAGGGCTCAGGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025054.4-1306s21c1
Sequence:CCGGCTCCGGTAGAAACCATTATATCTCGAGATATAATGGTTTCTACCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025054.4-1151s21c1
Sequence:CCGGGTGCTACATCGTCCTATTATTCTCGAGAATAATAGGACGATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025054.4-2194s21c1
Sequence:CCGGGAAAGTTGTCCACACTATATTCTCGAGAATATAGTGTGGACAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025054
VALIDATED
VCPIP1 MISSION shRNA shRNA Plasmid DNA
valosin containing protein (p97)/p47 complex interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025054.3-7090s1c1
Sequence:CCGGCCTCACTAATAACTAACCTTTCTCGAGAAAGGTTAGTTATTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-2239s1c1
Sequence:CCGGCGATGATTATACTCCTGTAAACTCGAGTTTACAGGAGTATAATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-1160s1c1
Sequence:CCGGCGTCCTATTATTCTGTTAGATCTCGAGATCTAACAGAATAATAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-2238s1c1
Sequence:CCGGCCGATGATTATACTCCTGTAACTCGAGTTACAGGAGTATAATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-1305s1c1
Sequence:CCGGGCTCCGGTAGAAACCATTATACTCGAGTATAATGGTTTCTACCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_025054.4-1395s21c1
Sequence:CCGGGTGTGCCTCAGGACCTTATTACTCGAGTAATAAGGTCCTGAGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025054.4-7944s21c1
Sequence:CCGGCTCGTCCTGAGCCCTTATTATCTCGAGATAATAAGGGCTCAGGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025054.4-1306s21c1
Sequence:CCGGCTCCGGTAGAAACCATTATATCTCGAGATATAATGGTTTCTACCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025054.4-1151s21c1
Sequence:CCGGGTGCTACATCGTCCTATTATTCTCGAGAATAATAGGACGATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025054.4-2194s21c1
Sequence:CCGGGAAAGTTGTCCACACTATATTCTCGAGAATATAGTGTGGACAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025054
VALIDATED
VCPIP1 MISSION shRNA Lentiviral Transduction Particles
valosin containing protein (p97)/p47 complex interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025054.3-7090s1c1
Sequence:CCGGCCTCACTAATAACTAACCTTTCTCGAGAAAGGTTAGTTATTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-2239s1c1
Sequence:CCGGCGATGATTATACTCCTGTAAACTCGAGTTTACAGGAGTATAATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-1160s1c1
Sequence:CCGGCGTCCTATTATTCTGTTAGATCTCGAGATCTAACAGAATAATAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-2238s1c1
Sequence:CCGGCCGATGATTATACTCCTGTAACTCGAGTTACAGGAGTATAATCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025054.3-1305s1c1
Sequence:CCGGGCTCCGGTAGAAACCATTATACTCGAGTATAATGGTTTCTACCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_025054.4-1395s21c1
Sequence:CCGGGTGTGCCTCAGGACCTTATTACTCGAGTAATAAGGTCCTGAGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025054.4-7944s21c1
Sequence:CCGGCTCGTCCTGAGCCCTTATTATCTCGAGATAATAAGGGCTCAGGACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025054.4-1306s21c1
Sequence:CCGGCTCCGGTAGAAACCATTATATCTCGAGATATAATGGTTTCTACCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025054.4-1151s21c1
Sequence:CCGGGTGCTACATCGTCCTATTATTCTCGAGAATAATAGGACGATGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025054.4-2194s21c1
Sequence:CCGGGAAAGTTGTCCACACTATATTCTCGAGAATATAGTGTGGACAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks