EMAIL THIS PAGE TO A FRIEND

VCX2

variable charge, X-linked 2

Synonyms: VCX-2r VCX2R VCXB
Species: Human VCX2(51480)
UniProtKB ID: Q9H322, A3KPB6, Q4V9T2, Q9P0H5
Gene ID:
Human(51480) Summary: This gene belongs to the VCX/Y gene family, which has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. The X-linked members are clustered on chromosome Xp22 and Y-linked members are two identical copies of the gene within a palindromic region on Yq11. The family members share a high degree of sequence identity, with the exception that a 30-bp unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. The VCX gene cluster is polymorphic in terms of copy number; different individuals may have a different number of VCX genes. VCX/Y genes encode small and highly charged proteins of unknown function. The presence of a putative bipartite nuclear localization signal suggests that VCX/Y members are nuclear proteins. This gene contains 2 repeats of the 30-bp unit. [provided by RefSeq, Jul 2008]
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016378 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108361 MISSION® esiRNA esiRNA human VCX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016378 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118398 predicted 334
2 SASI_Hs01_00118399 predicted 767
3 SASI_Hs02_00349373 predicted 771
4 SASI_Hs01_00118400 predicted 680
5 SASI_Hs01_00118401 predicted 671
6 SASI_Hs01_00118402 predicted 622
7 SASI_Hs01_00118403 predicted 657
8 SASI_Hs01_00118404 predicted 714
9 SASI_Hs01_00118405 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016378
VCX2 MISSION shRNA Bacterial Glycerol Stock
variable charge, X-linked 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000244688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-396s21c1
Sequence:CCGGACCCGAAGAAGAAGACTACCACTCGAGTGGTAGTCTTCTTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-633s21c1
Sequence:CCGGAGGTGGAAGAACCACTGAGTCCTCGAGGACTCAGTGGTTCTTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-409s21c1
Sequence:CCGGGACTACCAAGGTGGCCAAGAACTCGAGTTCTTGGCCACCTTGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-445s21c1
Sequence:CCGGTAGAGGGAGACGCGGGAAGAACTCGAGTTCTTCCCGCGTCTCCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016378
VCX2 MISSION shRNA shRNA Plasmid DNA
variable charge, X-linked 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000244688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-396s21c1
Sequence:CCGGACCCGAAGAAGAAGACTACCACTCGAGTGGTAGTCTTCTTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-633s21c1
Sequence:CCGGAGGTGGAAGAACCACTGAGTCCTCGAGGACTCAGTGGTTCTTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-409s21c1
Sequence:CCGGGACTACCAAGGTGGCCAAGAACTCGAGTTCTTGGCCACCTTGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-445s21c1
Sequence:CCGGTAGAGGGAGACGCGGGAAGAACTCGAGTTCTTCCCGCGTCTCCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016378
VCX2 MISSION shRNA Lentiviral Transduction Particles
variable charge, X-linked 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000244688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-396s21c1
Sequence:CCGGACCCGAAGAAGAAGACTACCACTCGAGTGGTAGTCTTCTTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-633s21c1
Sequence:CCGGAGGTGGAAGAACCACTGAGTCCTCGAGGACTCAGTGGTTCTTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-409s21c1
Sequence:CCGGGACTACCAAGGTGGCCAAGAACTCGAGTTCTTGGCCACCTTGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016378.2-445s21c1
Sequence:CCGGTAGAGGGAGACGCGGGAAGAACTCGAGTTCTTCCCGCGTCTCCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks