EMAIL THIS PAGE TO A FRIEND

VCX3A

variable charge, X-linked 3A

Synonyms: VCX-8r VCX-A VCX3 VCX8R VCXA
Species: Human VCX3A(51481)
UniProtKB ID: Q9NNX9, Q9P0H4
Gene ID:
Human(51481) Summary: This gene belongs to the VCX/Y gene family, which has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. The X-linked members are clustered on chromosome Xp22 and Y-linked members are two identical copies of the gene within a palindromic region on Yq11. The family members share a high degree of sequence identity, with the exception that a 30-bp unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. The VCX gene cluster is polymorphic in terms of copy number; different individuals may have a different number of VCX genes. VCX/Y genes encode small and highly charged proteins of unknown function. The presence of a putative bipartite nuclear localization signal suggests that VCX/Y members are nuclear proteins. This gene contains 8 repeats of the 30-bp unit. [provided by RefSeq, Jul 2008]
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016379 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016379 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175537 predicted 659
2 SASI_Hs01_00175538 predicted 667
3 SASI_Hs01_00175539 predicted 951
4 SASI_Hs02_00349374 predicted 949
5 SASI_Hs01_00175540 predicted 856
6 SASI_Hs01_00175541 predicted 835
7 SASI_Hs01_00175542 predicted 895
8 SASI_Hs01_00175543 predicted 889
9 SASI_Hs02_00349375 predicted 842
10 SASI_Hs02_00349376 predicted 854
11 SASI_Hs01_00175536 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016379
VCX3A MISSION shRNA Bacterial Glycerol Stock
variable charge, X-linked 3A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016379.3-633s21c1
Sequence:CCGGAGCTGGAGGAACCACTGAGTCCTCGAGGACTCAGTGGTTCCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016379.3-446s21c1
Sequence:CCGGAGAGGGAGACGCGGGAAGAAACTCGAGTTTCTTCCCGCGTCTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016379.3-693s21c1
Sequence:CCGGAGGTGGAGGAACCACTGAGTCCTCGAGGACTCAGTGGTTCCTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-397s1c1
Sequence:CCGGCCCGAAGAAGAAGACTACCAACTCGAGTTGGTAGTCTTCTTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-393s1c1
Sequence:CCGGGTGACCCGAAGAAGAAGACTACTCGAGTAGTCTTCTTCTTCGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-720s1c1
Sequence:CCGGGCGAGGTGGAAGAACCACTGACTCGAGTCAGTGGTTCTTCCACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-846s1c1
Sequence:CCGGTGGAAGAACTACCGAGTGTGTCTCGAGACACACTCGGTAGTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016379
VCX3A MISSION shRNA shRNA Plasmid DNA
variable charge, X-linked 3A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016379.3-633s21c1
Sequence:CCGGAGCTGGAGGAACCACTGAGTCCTCGAGGACTCAGTGGTTCCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016379.3-446s21c1
Sequence:CCGGAGAGGGAGACGCGGGAAGAAACTCGAGTTTCTTCCCGCGTCTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016379.3-693s21c1
Sequence:CCGGAGGTGGAGGAACCACTGAGTCCTCGAGGACTCAGTGGTTCCTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-397s1c1
Sequence:CCGGCCCGAAGAAGAAGACTACCAACTCGAGTTGGTAGTCTTCTTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-393s1c1
Sequence:CCGGGTGACCCGAAGAAGAAGACTACTCGAGTAGTCTTCTTCTTCGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-720s1c1
Sequence:CCGGGCGAGGTGGAAGAACCACTGACTCGAGTCAGTGGTTCTTCCACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-846s1c1
Sequence:CCGGTGGAAGAACTACCGAGTGTGTCTCGAGACACACTCGGTAGTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016379
VCX3A MISSION shRNA Lentiviral Transduction Particles
variable charge, X-linked 3A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016379.3-633s21c1
Sequence:CCGGAGCTGGAGGAACCACTGAGTCCTCGAGGACTCAGTGGTTCCTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016379.3-446s21c1
Sequence:CCGGAGAGGGAGACGCGGGAAGAAACTCGAGTTTCTTCCCGCGTCTCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016379.3-693s21c1
Sequence:CCGGAGGTGGAGGAACCACTGAGTCCTCGAGGACTCAGTGGTTCCTCCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-397s1c1
Sequence:CCGGCCCGAAGAAGAAGACTACCAACTCGAGTTGGTAGTCTTCTTCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-393s1c1
Sequence:CCGGGTGACCCGAAGAAGAAGACTACTCGAGTAGTCTTCTTCTTCGGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-720s1c1
Sequence:CCGGGCGAGGTGGAAGAACCACTGACTCGAGTCAGTGGTTCTTCCACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016379.2-846s1c1
Sequence:CCGGTGGAAGAACTACCGAGTGTGTCTCGAGACACACTCGGTAGTTCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks