EMAIL THIS PAGE TO A FRIEND

VCX3B

variable charge, X-linked 3B

Synonyms: VCX-C VCXC
Species: Human VCX3B(425054)
UniProtKB ID: Q9H321, Q4KN12
Gene ID:
Human(425054) Summary: This gene belongs to the VCX/Y gene family, which has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. The X-linked members are clustered on chromosome Xp22, and the Y-linked members are two identical copies of the gene within a palindromic region on chromosome Yq11. The family members share a high degree of sequence identity, with the exception that a 30-nt unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. The VCX gene cluster is polymorphic in terms of copy number; different individuals may have a different number of VCX genes. This family member, as represented by the reference genome allele, contains 14 copies of the 30-nt repeat unit. VCX/Y genes encode small and highly charged proteins containing putative bipartite nuclear localization signals. Although the exact function of this family member has yet to be determined, a role in mRNA stability regulation can be inferred from the ability of the highly similar family member, VCX-A, to inhibit mRNA decapping. A possible role in the regulation of ribosome assembly during spermatogenesis has also been suggested. [provided by RefSeq, Aug 2010]
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001888 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001888 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303968 predicted 824
2 SASI_Hs02_00303969 predicted 392
3 SASI_Hs01_00227881 predicted 659
4 SASI_Hs02_00303970 predicted 404
5 SASI_Hs02_00303971 predicted 346
6 SASI_Hs02_00303972 predicted 354
7 SASI_Hs01_00227879 predicted 846
8 SASI_Hs01_00227880 predicted 684
9 SASI_Hs01_00227882 predicted 846
10 SASI_Hs01_00227883 predicted 740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001888
VCX3B MISSION shRNA Bacterial Glycerol Stock
variable charge, X-linked 3B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-398s1c1
Sequence:CCGGCCGAAGAAGAAGACTACCAAGCTCGAGCTTGGTAGTCTTCTTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-393s1c1
Sequence:CCGGGTGACCCGAAGAAGAAGACTACTCGAGTAGTCTTCTTCTTCGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-926s1c1
Sequence:CCGGGAGAGCGAGATGGAAGAACTACTCGAGTAGTTCTTCCATCTCGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-932s1c1
Sequence:CCGGGAGATGGAAGAACTACCGAGTCTCGAGACTCGGTAGTTCTTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-844s1c1
Sequence:CCGGGATGGAAGAACCACTGAGTCACTCGAGTGACTCAGTGGTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-934s1c1
Sequence:CCGGGATGGAAGAACTACCGAGTGTCTCGAGACACTCGGTAGTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-842s1c1
Sequence:CCGGGAGATGGAAGAACCACTGAGTCTCGAGACTCAGTGGTTCTTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-397s1c1
Sequence:CCGGCCCGAAGAAGAAGACTACCAACTCGAGTTGGTAGTCTTCTTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-400s1c1
Sequence:CCGGGAAGAAGAAGACTACCAAGGTCTCGAGACCTTGGTAGTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001888
VCX3B MISSION shRNA shRNA Plasmid DNA
variable charge, X-linked 3B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-398s1c1
Sequence:CCGGCCGAAGAAGAAGACTACCAAGCTCGAGCTTGGTAGTCTTCTTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-393s1c1
Sequence:CCGGGTGACCCGAAGAAGAAGACTACTCGAGTAGTCTTCTTCTTCGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-926s1c1
Sequence:CCGGGAGAGCGAGATGGAAGAACTACTCGAGTAGTTCTTCCATCTCGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-932s1c1
Sequence:CCGGGAGATGGAAGAACTACCGAGTCTCGAGACTCGGTAGTTCTTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-844s1c1
Sequence:CCGGGATGGAAGAACCACTGAGTCACTCGAGTGACTCAGTGGTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-934s1c1
Sequence:CCGGGATGGAAGAACTACCGAGTGTCTCGAGACACTCGGTAGTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-842s1c1
Sequence:CCGGGAGATGGAAGAACCACTGAGTCTCGAGACTCAGTGGTTCTTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-397s1c1
Sequence:CCGGCCCGAAGAAGAAGACTACCAACTCGAGTTGGTAGTCTTCTTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-400s1c1
Sequence:CCGGGAAGAAGAAGACTACCAAGGTCTCGAGACCTTGGTAGTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001888
VCX3B MISSION shRNA Lentiviral Transduction Particles
variable charge, X-linked 3B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-398s1c1
Sequence:CCGGCCGAAGAAGAAGACTACCAAGCTCGAGCTTGGTAGTCTTCTTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-393s1c1
Sequence:CCGGGTGACCCGAAGAAGAAGACTACTCGAGTAGTCTTCTTCTTCGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-926s1c1
Sequence:CCGGGAGAGCGAGATGGAAGAACTACTCGAGTAGTTCTTCCATCTCGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-932s1c1
Sequence:CCGGGAGATGGAAGAACTACCGAGTCTCGAGACTCGGTAGTTCTTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-844s1c1
Sequence:CCGGGATGGAAGAACCACTGAGTCACTCGAGTGACTCAGTGGTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-934s1c1
Sequence:CCGGGATGGAAGAACTACCGAGTGTCTCGAGACACTCGGTAGTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-842s1c1
Sequence:CCGGGAGATGGAAGAACCACTGAGTCTCGAGACTCAGTGGTTCTTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001888.1-397s1c1
Sequence:CCGGCCCGAAGAAGAAGACTACCAACTCGAGTTGGTAGTCTTCTTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001888.1-400s1c1
Sequence:CCGGGAAGAAGAAGACTACCAAGGTCTCGAGACCTTGGTAGTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks