EMAIL THIS PAGE TO A FRIEND

VCX

variable charge, X-linked

Synonyms: VCX-10r VCX-B1 VCX1 VCX10R VCXB1
Species: Human VCX(26609)
UniProtKB ID: Q9H320, Q9P0H3
Gene ID:
Human(26609) Summary: This gene belongs to the VCX/Y gene family, which has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. The X-linked members are clustered on chromosome Xp22 and Y-linked members are two identical copies of the gene within a palindromic region on Yq11. The family members share a high degree of sequence identity, with the exception that a 30-bp unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. The VCX gene cluster is polymorphic in terms of copy number; different individuals may have a different number of VCX genes. VCX/Y genes encode small and highly charged proteins of unknown function. The presence of a putative bipartite nuclear localization signal suggests that VCX/Y members are nuclear proteins. This gene contains 10 repeats of the 30-bp unit. [provided by RefSeq, Jul 2008]
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013452 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013452 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144572 predicted 634
2 SASI_Hs01_00144573 predicted 577
3 SASI_Hs01_00144574 predicted 923
4 SASI_Hs02_00344867 predicted 921
5 SASI_Hs01_00144575 predicted 829
6 SASI_Hs02_00344868 predicted 826
7 SASI_Hs01_00144577 predicted 810
8 SASI_Hs01_00144578 predicted 866
9 SASI_Hs02_00344869 predicted 807
10 SASI_Hs02_00344870 predicted 850
11 SASI_Hs01_00144571 predicted 714
12 SASI_Hs01_00144576 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013452
VCX MISSION shRNA Bacterial Glycerol Stock
variable charge, X-linked
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-564s21c1
Sequence:CCGGTCAGGAGAGCGAGGTGGAAGACTCGAGTCTTCCACCTCGCTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-738s21c1
Sequence:CCGGACTGAGTCAGGAGAGCGAGATCTCGAGATCTCGCTCTCCTGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-551s21c1
Sequence:CCGGAGGAACCACTGAGTCAGGAGACTCGAGTCTCCTGACTCAGTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-805s21c1
Sequence:CCGGCAGGAGAGCGAGATGGAAGAACTCGAGTTCTTCCATCTCGCTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-755s21c1
Sequence:CCGGAGATGGAAGAACCACTGAGTCCTCGAGGACTCAGTGGTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013452
VCX MISSION shRNA shRNA Plasmid DNA
variable charge, X-linked
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-564s21c1
Sequence:CCGGTCAGGAGAGCGAGGTGGAAGACTCGAGTCTTCCACCTCGCTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-738s21c1
Sequence:CCGGACTGAGTCAGGAGAGCGAGATCTCGAGATCTCGCTCTCCTGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-551s21c1
Sequence:CCGGAGGAACCACTGAGTCAGGAGACTCGAGTCTCCTGACTCAGTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-805s21c1
Sequence:CCGGCAGGAGAGCGAGATGGAAGAACTCGAGTTCTTCCATCTCGCTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-755s21c1
Sequence:CCGGAGATGGAAGAACCACTGAGTCCTCGAGGACTCAGTGGTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013452
VCX MISSION shRNA Lentiviral Transduction Particles
variable charge, X-linked
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-564s21c1
Sequence:CCGGTCAGGAGAGCGAGGTGGAAGACTCGAGTCTTCCACCTCGCTCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-738s21c1
Sequence:CCGGACTGAGTCAGGAGAGCGAGATCTCGAGATCTCGCTCTCCTGACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-551s21c1
Sequence:CCGGAGGAACCACTGAGTCAGGAGACTCGAGTCTCCTGACTCAGTGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-805s21c1
Sequence:CCGGCAGGAGAGCGAGATGGAAGAACTCGAGTTCTTCCATCTCGCTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013452.2-755s21c1
Sequence:CCGGAGATGGAAGAACCACTGAGTCCTCGAGGACTCAGTGGTTCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks