EMAIL THIS PAGE TO A FRIEND

VCY1B

variable charge, Y-linked 1B

Synonyms: BPY1B
Species: Human VCY1B(353513)
Gene ID:
Human(353513) Summary: The protein encoded by this gene is a member of a family of human VCX/Y genes. This gene family has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. Members of the VCX/Y family share a high degree of sequence identity, with the exception that a 30-bp unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. VCX/Y genes encode small and highly charged proteins of unknown function. This gene encodes a small, positively charged protein. The presence of a putative bipartite nuclear localization signal suggests that this gene encodes a nuclear protein. The genome has two identical copies of this gene within a palindromic region; this record represents the more telomeric copy. [provided by RefSeq, Jul 2008]
11 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181880 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181880 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145239 predicted 430
2 SASI_Hs01_00145240 predicted 433
3 SASI_Hs01_00145241 predicted 181
4 SASI_Hs01_00145244 predicted 431
5 SASI_Hs01_00145246 predicted 434
6 SASI_Hs01_00145247 predicted 492
7 SASI_Hs01_00145245 predicted 501
8 SASI_Hs01_00145242 predicted 391
9 SASI_Hs01_00145243 predicted 399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181880
VCY1B MISSION shRNA Bacterial Glycerol Stock
variable charge, Y-linked 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-187s21c1
Sequence:CCGGAGAAGGGAGAAGCAGTTCGTGCTCGAGCACGAACTGCTTCTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-106s21c1
Sequence:CCGGAGGCCAAGGAGACAGGAAAGACTCGAGTCTTTCCTGTCTCCTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-117s21c1
Sequence:CCGGACAGGAAAGAGGAAGTCCTCCCTCGAGGGAGGACTTCCTCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-160s21c1
Sequence:CCGGCGAAGAAGAAGACTACCAAGGCTCGAGCCTTGGTAGTCTTCTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-394s21c1
Sequence:CCGGAGCTGGAGGAACCACTGAGTACTCGAGTACTCAGTGGTTCCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181880
VCY1B MISSION shRNA shRNA Plasmid DNA
variable charge, Y-linked 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-187s21c1
Sequence:CCGGAGAAGGGAGAAGCAGTTCGTGCTCGAGCACGAACTGCTTCTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-106s21c1
Sequence:CCGGAGGCCAAGGAGACAGGAAAGACTCGAGTCTTTCCTGTCTCCTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-117s21c1
Sequence:CCGGACAGGAAAGAGGAAGTCCTCCCTCGAGGGAGGACTTCCTCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-160s21c1
Sequence:CCGGCGAAGAAGAAGACTACCAAGGCTCGAGCCTTGGTAGTCTTCTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-394s21c1
Sequence:CCGGAGCTGGAGGAACCACTGAGTACTCGAGTACTCAGTGGTTCCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181880
VCY1B MISSION shRNA Lentiviral Transduction Particles
variable charge, Y-linked 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-187s21c1
Sequence:CCGGAGAAGGGAGAAGCAGTTCGTGCTCGAGCACGAACTGCTTCTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-106s21c1
Sequence:CCGGAGGCCAAGGAGACAGGAAAGACTCGAGTCTTTCCTGTCTCCTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-117s21c1
Sequence:CCGGACAGGAAAGAGGAAGTCCTCCCTCGAGGGAGGACTTCCTCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-160s21c1
Sequence:CCGGCGAAGAAGAAGACTACCAAGGCTCGAGCCTTGGTAGTCTTCTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181880.1-394s21c1
Sequence:CCGGAGCTGGAGGAACCACTGAGTACTCGAGTACTCAGTGGTTCCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks