EMAIL THIS PAGE TO A FRIEND

VCY

variable charge, Y-linked

Synonyms: BPY1 VCY1 VCY1A
Species: Human VCY(9084)
UniProtKB ID: O14598
Gene ID:
Human(9084) Summary: The protein encoded by this gene is a member of a family of human VCX/Y genes. This gene family has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. Members of the VCX/Y family share a high degree of sequence identity, with the exception that a 30-bp unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. VCX/Y genes encode small and highly charged proteins of unknown function. This gene encodes a small, positively charged protein. The presence of a putative bipartite nuclear localization signal suggests that this gene encodes a nuclear protein. The genome has two identical copies of this gene within a palindromic region; this record represents the more centromeric copy. [provided by RefSeq, Jul 2008]
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004679 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004679 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114439 predicted 433
2 SASI_Hs01_00114440 predicted 444
3 SASI_Hs01_00114441 predicted 183
4 SASI_Hs01_00114442 predicted 439
5 SASI_Hs01_00114444 predicted 437
6 SASI_Hs01_00114445 predicted 494
7 SASI_Hs01_00114443 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004679
VCY MISSION shRNA Bacterial Glycerol Stock
variable charge, Y-linked
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-174s21c1
Sequence:CCGGGACTACCAAGGTGGCCGAGAACTCGAGTTCTCGGCCACCTTGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-108s21c1
Sequence:CCGGCAAGGCCAAGGAGACAGGAAACTCGAGTTTCCTGTCTCCTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-161s21c1
Sequence:CCGGGCCCGAAGAAGAAGACTACCACTCGAGTGGTAGTCTTCTTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-120s21c1
Sequence:CCGGGACAGGAAAGAGGAAGTCCTCCTCGAGGAGGACTTCCTCTTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004679
VCY MISSION shRNA shRNA Plasmid DNA
variable charge, Y-linked
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-174s21c1
Sequence:CCGGGACTACCAAGGTGGCCGAGAACTCGAGTTCTCGGCCACCTTGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-108s21c1
Sequence:CCGGCAAGGCCAAGGAGACAGGAAACTCGAGTTTCCTGTCTCCTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-161s21c1
Sequence:CCGGGCCCGAAGAAGAAGACTACCACTCGAGTGGTAGTCTTCTTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-120s21c1
Sequence:CCGGGACAGGAAAGAGGAAGTCCTCCTCGAGGAGGACTTCCTCTTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004679
VCY MISSION shRNA Lentiviral Transduction Particles
variable charge, Y-linked
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-174s21c1
Sequence:CCGGGACTACCAAGGTGGCCGAGAACTCGAGTTCTCGGCCACCTTGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-108s21c1
Sequence:CCGGCAAGGCCAAGGAGACAGGAAACTCGAGTTTCCTGTCTCCTTGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-161s21c1
Sequence:CCGGGCCCGAAGAAGAAGACTACCACTCGAGTGGTAGTCTTCTTCTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004679.2-120s21c1
Sequence:CCGGGACAGGAAAGAGGAAGTCCTCCTCGAGGAGGACTTCCTCTTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks