EMAIL THIS PAGE TO A FRIEND

VDAC1

voltage-dependent anion channel 1

Synonyms: PORIN VDAC-1
UniProtKB ID: P21796, B3KVK4, D3DQ93, Q5FVE7, Q9UIQ5, Q9UPL0
Gene ID:
Human(7416) Summary: This gene encodes a voltage-dependent anion channel protein that is a major component of the outer mitochondrial membrane. The encoded protein facilitates the exchange of metabolites and ions across the outer mitochondrial membrane and may regulate mitochondrial functions. This protein also forms channels in the plasma membrane and may be involved in transmembrane electron transport. Alternate splicing results in multiple transcript variants. Multiple pseudogenes of this gene are found on chromosomes 1, 2 3, 6, 9, 12, X and Y.[provided by RefSeq, Sep 2010]
Mouse(22333) voltage-dependent anion channel 1
Rat(83529) voltage-dependent anion channel 1
Thale Cress(820914) voltage dependent anion channel 1
Zebrafish(334582) voltage-dependent anion channel 1
chicken(416320) voltage-dependent anion channel 1
domestic cat(101098515) voltage-dependent anion channel 1
dog(474681) voltage-dependent anion channel 1
domestic guinea pig(100723897) voltage-dependent anion channel 1
Domestic Rabbit(100008751) voltage-dependent anion channel 1
naked mole-rat(101708247) voltage-dependent anion channel 1
cow(282119) voltage-dependent anion channel 1
sheep(100145866) voltage-dependent anion channel 1
Gene Class: Apoptosis
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
V2139 Anti-VDAC/Porin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat, human
microarray, western blot pricing
SAB2108496 Anti-VDAC1 IgG fraction of antiserum rat, bovine, horse, rabbit, sheep, mouse, bovine, canine, guinea pig, zebrafish
immunohistochemistry, western blot pricing
AV35122 Anti-VDAC1 antibody produced in rabbit IgG fraction of antiserum canine, horse, rabbit, guinea pig, sheep, pig, zebrafish, rat, rabbit, bovine, human, mouse
immunohistochemistry, western blot pricing
HPA030780 Anti-VDAC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5201383 Monoclonal Anti-Vdac1 - Alkaline Phosphatase antibody produced in mouse clone S152B-23, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201384 Monoclonal Anti-Vdac1 - Apc antibody produced in mouse clone S152B-23, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201375 Monoclonal Anti-Vdac1 - Atto 390 antibody produced in mouse clone S152B-23, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201376 Monoclonal Anti-Vdac1 - Atto 488 antibody produced in mouse clone S152B-23, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201377 Monoclonal Anti-Vdac1 - Atto 565 antibody produced in mouse clone S152B-23, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201378 Monoclonal Anti-Vdac1 - Atto 594 antibody produced in mouse clone S152B-23, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201379 Monoclonal Anti-Vdac1 - Atto 633 antibody produced in mouse clone S152B-23, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201380 Monoclonal Anti-Vdac1 - Atto 655 antibody produced in mouse clone S152B-23, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201381 Monoclonal Anti-Vdac1 - Atto 680 antibody produced in mouse clone S152B-23, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201382 Monoclonal Anti-Vdac1 - Atto 700 antibody produced in mouse clone S152B-23, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201385 Monoclonal Anti-Vdac1 - Biotin antibody produced in mouse clone S152B-23, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201386 Monoclonal Anti-Vdac1 - Fitc antibody produced in mouse clone S152B-23, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201387 Monoclonal Anti-Vdac1 - Hrp antibody produced in mouse clone S152B-23, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201388 Monoclonal Anti-Vdac1 - Pe/Atto 594 antibody produced in mouse clone S152B-23, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201389 Monoclonal Anti-Vdac1 - Percp antibody produced in mouse clone S152B-23, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201390 Monoclonal Anti-Vdac1 - Rpe antibody produced in mouse clone S152B-23, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201391 Monoclonal Anti-Vdac1 - Streptavidin antibody produced in mouse clone S152B-23, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201374 Monoclonal Anti-Vdac1 antibody produced in mouse clone S152B-23, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
WH0007416M5 Monoclonal Anti-VDAC1 antibody produced in mouse clone 4C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404524 Monoclonal Anti-VDAC1 antibody produced in mouse clone 2A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003374 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003374 Rosetta Predictions human pricing
NM_031353 Rosetta Predictions rat pricing
NM_011694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012464 predicted 829
2 SASI_Hs01_00012466 predicted 740
3 SASI_Hs01_00012467 predicted 1240
4 SASI_Hs01_00012468 predicted 755
5 SASI_Hs01_00012469 predicted 840
6 SASI_Hs01_00012470 predicted 826
7 SASI_Hs01_00012471 predicted 852
8 SASI_Hs01_00012472 predicted 642
9 SASI_Hs02_00335535 predicted 653
10 SASI_Hs02_00335536 predicted 732
11 SASI_Hs01_00012465 predicted 1086
12 SASI_Hs01_00012473 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112831 predicted 1010
2 SASI_Rn01_00112834 predicted 908
3 SASI_Rn02_00264601 predicted 949
4 SASI_Rn01_00112835 predicted 916
5 SASI_Rn01_00112836 predicted 898
6 SASI_Rn01_00112838 predicted 1057
7 SASI_Rn02_00264602 predicted 1024
8 SASI_Rn02_00264603 predicted 1034
9 SASI_Rn02_00264604 predicted 1021
10 SASI_Rn02_00264605 predicted 1043
11 SASI_Rn01_00112832 predicted 831
12 SASI_Rn01_00112833 predicted 786
13 SASI_Rn01_00112837 predicted 713
14 SASI_Rn01_00112839 predicted 627
15 SASI_Rn01_00112840 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321250 predicted 749
2 SASI_Mm01_00111834 predicted 677
3 SASI_Mm01_00111835 predicted 1124
4 SASI_Mm01_00111836 predicted 1002
5 SASI_Mm01_00111839 predicted 986
6 SASI_Mm02_00321251 predicted 613
7 SASI_Mm01_00111841 predicted 1160
8 SASI_Mm01_00111842 predicted 1041
9 SASI_Mm01_00111843 predicted 887
10 SASI_Mm02_00321252 predicted 1020
11 SASI_Mm01_00111837 predicted 878
12 SASI_Mm01_00111838 predicted 894
13 SASI_Mm01_00111840 predicted 1038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003374
VALIDATED
VDAC1 MISSION shRNA Bacterial Glycerol Stock
voltage-dependent anion channel 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-607s21c1
Sequence:CCGGGCAGTTGGCTACAAGACTGATCTCGAGATCAGTCTTGTAGCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-161s21c1
Sequence:CCGGGCTATGGATTTGGCTTAATAACTCGAGTTATTAAGCCAAATCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-279s21c1
Sequence:CCGGCAAGTACAGATGGACTGAGTACTCGAGTACTCAGTCCATCTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-396s21c1
Sequence:CCGGCGATTCATCCTTCTCACCTAACTCGAGTTAGGTGAGAAGGATGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-921s21c1
Sequence:CCGGGCTTGGTCTAGGACTGGAATTCTCGAGAATTCCAGTCCTAGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-161s1c1
Sequence:CCGGGCTATGGATTTGGCTTAATAACTCGAGTTATTAAGCCAAATCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-396s1c1
Sequence:CCGGCGATTCATCCTTCTCACCTAACTCGAGTTAGGTGAGAAGGATGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-279s1c1
Sequence:CCGGCAAGTACAGATGGACTGAGTACTCGAGTACTCAGTCCATCTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-607s1c1
Sequence:CCGGGCAGTTGGCTACAAGACTGATCTCGAGATCAGTCTTGTAGCCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-921s1c1
Sequence:CCGGGCTTGGTCTAGGACTGGAATTCTCGAGAATTCCAGTCCTAGACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003374
VALIDATED
VDAC1 MISSION shRNA shRNA Plasmid DNA
voltage-dependent anion channel 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-607s21c1
Sequence:CCGGGCAGTTGGCTACAAGACTGATCTCGAGATCAGTCTTGTAGCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-161s21c1
Sequence:CCGGGCTATGGATTTGGCTTAATAACTCGAGTTATTAAGCCAAATCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-279s21c1
Sequence:CCGGCAAGTACAGATGGACTGAGTACTCGAGTACTCAGTCCATCTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-396s21c1
Sequence:CCGGCGATTCATCCTTCTCACCTAACTCGAGTTAGGTGAGAAGGATGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-921s21c1
Sequence:CCGGGCTTGGTCTAGGACTGGAATTCTCGAGAATTCCAGTCCTAGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-161s1c1
Sequence:CCGGGCTATGGATTTGGCTTAATAACTCGAGTTATTAAGCCAAATCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-396s1c1
Sequence:CCGGCGATTCATCCTTCTCACCTAACTCGAGTTAGGTGAGAAGGATGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-279s1c1
Sequence:CCGGCAAGTACAGATGGACTGAGTACTCGAGTACTCAGTCCATCTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-607s1c1
Sequence:CCGGGCAGTTGGCTACAAGACTGATCTCGAGATCAGTCTTGTAGCCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-921s1c1
Sequence:CCGGGCTTGGTCTAGGACTGGAATTCTCGAGAATTCCAGTCCTAGACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003374
VALIDATED
VDAC1 MISSION shRNA Lentiviral Transduction Particles
voltage-dependent anion channel 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-607s21c1
Sequence:CCGGGCAGTTGGCTACAAGACTGATCTCGAGATCAGTCTTGTAGCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-161s21c1
Sequence:CCGGGCTATGGATTTGGCTTAATAACTCGAGTTATTAAGCCAAATCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-279s21c1
Sequence:CCGGCAAGTACAGATGGACTGAGTACTCGAGTACTCAGTCCATCTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-396s21c1
Sequence:CCGGCGATTCATCCTTCTCACCTAACTCGAGTTAGGTGAGAAGGATGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003374.1-921s21c1
Sequence:CCGGGCTTGGTCTAGGACTGGAATTCTCGAGAATTCCAGTCCTAGACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-161s1c1
Sequence:CCGGGCTATGGATTTGGCTTAATAACTCGAGTTATTAAGCCAAATCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-396s1c1
Sequence:CCGGCGATTCATCCTTCTCACCTAACTCGAGTTAGGTGAGAAGGATGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-279s1c1
Sequence:CCGGCAAGTACAGATGGACTGAGTACTCGAGTACTCAGTCCATCTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-607s1c1
Sequence:CCGGGCAGTTGGCTACAAGACTGATCTCGAGATCAGTCTTGTAGCCAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003374.1-921s1c1
Sequence:CCGGGCTTGGTCTAGGACTGGAATTCTCGAGAATTCCAGTCCTAGACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011694
VALIDATED
VDAC1 MISSION shRNA Bacterial Glycerol Stock
voltage-dependent anion channel 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011694.4-990s21c1
Sequence:CCGGGAGTTGATAAATACCACGTTACTCGAGTAACGTGGTATTTATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-552s21c1
Sequence:CCGGGTTGGCTATAAGACGGATGAACTCGAGTTCATCCGTCTTATAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-797s21c1
Sequence:CCGGACCAGGTATCAAACTGACGTTCTCGAGAACGTCAGTTTGATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-211s21c1
Sequence:CCGGGCCTGGAAACCAAGTACAGATCTCGAGATCTGTACTTGGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-103s21c1
Sequence:CCGGGCTACGGCTTTGGCTTAATAACTCGAGTTATTAAGCCAAAGCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-797s1c1
Sequence:CCGGACCAGGTATCAAACTGACGTTCTCGAGAACGTCAGTTTGATACCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-552s1c1
Sequence:CCGGGTTGGCTATAAGACGGATGAACTCGAGTTCATCCGTCTTATAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011694.1-211s1c1
Sequence:CCGGGCCTGGAAACCAAGTACAGATCTCGAGATCTGTACTTGGTTTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-103s1c1
Sequence:CCGGGCTACGGCTTTGGCTTAATAACTCGAGTTATTAAGCCAAAGCCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-990s1c1
Sequence:CCGGGAGTTGATAAATACCACGTTACTCGAGTAACGTGGTATTTATCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011694
VALIDATED
VDAC1 MISSION shRNA shRNA Plasmid DNA
voltage-dependent anion channel 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011694.4-990s21c1
Sequence:CCGGGAGTTGATAAATACCACGTTACTCGAGTAACGTGGTATTTATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-552s21c1
Sequence:CCGGGTTGGCTATAAGACGGATGAACTCGAGTTCATCCGTCTTATAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-797s21c1
Sequence:CCGGACCAGGTATCAAACTGACGTTCTCGAGAACGTCAGTTTGATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-211s21c1
Sequence:CCGGGCCTGGAAACCAAGTACAGATCTCGAGATCTGTACTTGGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-103s21c1
Sequence:CCGGGCTACGGCTTTGGCTTAATAACTCGAGTTATTAAGCCAAAGCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-797s1c1
Sequence:CCGGACCAGGTATCAAACTGACGTTCTCGAGAACGTCAGTTTGATACCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-552s1c1
Sequence:CCGGGTTGGCTATAAGACGGATGAACTCGAGTTCATCCGTCTTATAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011694.1-211s1c1
Sequence:CCGGGCCTGGAAACCAAGTACAGATCTCGAGATCTGTACTTGGTTTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-103s1c1
Sequence:CCGGGCTACGGCTTTGGCTTAATAACTCGAGTTATTAAGCCAAAGCCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-990s1c1
Sequence:CCGGGAGTTGATAAATACCACGTTACTCGAGTAACGTGGTATTTATCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011694
VALIDATED
VDAC1 MISSION shRNA Lentiviral Transduction Particles
voltage-dependent anion channel 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011694.4-990s21c1
Sequence:CCGGGAGTTGATAAATACCACGTTACTCGAGTAACGTGGTATTTATCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-552s21c1
Sequence:CCGGGTTGGCTATAAGACGGATGAACTCGAGTTCATCCGTCTTATAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-797s21c1
Sequence:CCGGACCAGGTATCAAACTGACGTTCTCGAGAACGTCAGTTTGATACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-211s21c1
Sequence:CCGGGCCTGGAAACCAAGTACAGATCTCGAGATCTGTACTTGGTTTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011694.4-103s21c1
Sequence:CCGGGCTACGGCTTTGGCTTAATAACTCGAGTTATTAAGCCAAAGCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-797s1c1
Sequence:CCGGACCAGGTATCAAACTGACGTTCTCGAGAACGTCAGTTTGATACCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-552s1c1
Sequence:CCGGGTTGGCTATAAGACGGATGAACTCGAGTTCATCCGTCTTATAGCCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011694.1-211s1c1
Sequence:CCGGGCCTGGAAACCAAGTACAGATCTCGAGATCTGTACTTGGTTTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-103s1c1
Sequence:CCGGGCTACGGCTTTGGCTTAATAACTCGAGTTATTAAGCCAAAGCCGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011694.1-990s1c1
Sequence:CCGGGAGTTGATAAATACCACGTTACTCGAGTAACGTGGTATTTATCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks