EMAIL THIS PAGE TO A FRIEND

VDAC2

voltage-dependent anion channel 2

Synonyms: POR
Gene ID:
Human(7417) Summary: This gene encodes a member of the voltage-dependent anion channel pore-forming family of proteins that are considered the main pathway for metabolite diffusion across the mitochondrial outer membrane. The encoded protein is also thought to be involved in the mitochondrial apoptotic pathway via regulation of BCL2-antagonist/killer 1 protein activity. Pseudogenes have been identified on chromosomes 1, 2, 12 and 21, and alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(22334) voltage-dependent anion channel 2
Rat(83531) voltage-dependent anion channel 2
Thale Cress(836886) voltage dependent anion channel 2
domestic cat(101092793) voltage-dependent anion channel 2
dog(479255) voltage-dependent anion channel 2
chicken(395498) voltage-dependent anion channel 2
Zebrafish(322126) voltage-dependent anion channel 2
cow(282120) voltage-dependent anion channel 2
sheep(101103533) voltage-dependent anion channel 2
naked mole-rat(101723570) voltage-dependent anion channel 2
Domestic Rabbit(100009473) voltage-dependent anion channel 2
domestic guinea pig(100723838) voltage-dependent anion channel 2
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0296 AQUA Peptide LTLSALVDG[K] African clawed frog, cow, dog, human, mouse, pig, rat pricing
AQ0297 AQUA Peptide YQLDPTASISA[K] cow, dog, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003375 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003375 Rosetta Predictions human pricing
NM_031354 Rosetta Predictions rat pricing
NM_011695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107813 predicted 1073
2 SASI_Hs01_00107814 predicted 540
3 SASI_Hs01_00107815 predicted 911
4 SASI_Hs01_00107816 predicted 650
5 SASI_Hs01_00107817 predicted 546
6 SASI_Hs01_00107819 predicted 894
7 SASI_Hs02_00335537 predicted 544
8 SASI_Hs01_00107821 predicted 223
9 SASI_Hs01_00107822 predicted 444
10 SASI_Hs02_00335538 predicted 968
11 SASI_Hs01_00107818 predicted 329
12 SASI_Hs01_00107820 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084986 predicted 785
2 SASI_Rn01_00084987 predicted 393
3 SASI_Rn02_00264606 predicted 416
4 SASI_Rn02_00264607 predicted 669
5 SASI_Rn01_00084988 predicted 547
6 SASI_Rn01_00084989 predicted 485
7 SASI_Rn02_00264608 predicted 892
8 SASI_Rn01_00084990 predicted 387
9 SASI_Rn01_00084991 predicted 337
10 SASI_Rn01_00084992 predicted 913
11 SASI_Rn01_00084993 predicted 711
12 SASI_Rn01_00084994 predicted 224
13 SASI_Rn01_00084995 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321253 predicted 749
2 SASI_Mm01_00137642 predicted 345
3 SASI_Mm01_00137643 predicted 303
4 SASI_Mm01_00137644 predicted 413
5 SASI_Mm01_00137645 predicted 437
6 SASI_Mm01_00137647 predicted 1029
7 SASI_Mm01_00137639 predicted 840
8 SASI_Mm01_00137640 predicted 523
9 SASI_Mm01_00137641 predicted 664
10 SASI_Mm02_00321254 predicted 869
11 SASI_Mm01_00137646 predicted 512
12 SASI_Mm01_00137648 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011695
VALIDATED
VDAC2 MISSION shRNA Bacterial Glycerol Stock
voltage-dependent anion channel 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011695.1-348s1c1
Sequence:CCGGCAAGTACAAATGGTGTGAGTACTCGAGTACTCACACCATTTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011695.1-545s1c1
Sequence:CCGGGCTGTGATGTTGACTTTGATTCTCGAGAATCAAAGTCAACATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011695.1-444s1c1
Sequence:CCGGTCAAGGTTTGAAACTGACTTTCTCGAGAAAGTCAGTTTCAAACCTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1273s21c1
Sequence:CCGGATGATGAAATAGACGTTTATGCTCGAGCATAAACGTCTATTTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-264s21c1
Sequence:CCGGGACGAAGTCATGCAGCGGTGTCTCGAGACACCGCTGCATGACTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-385s21c1
Sequence:CCGGGAGAAGTGGAACACCGATAACCTCGAGGTTATCGGTGTTCCACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1302s21c1
Sequence:CCGGGCCATGGTGTGCATGTTTGTTCTCGAGAACAAACATGCACACCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1477s21c1
Sequence:CCGGATAACTAATGGCTCACGTATGCTCGAGCATACGTGAGCCATTAGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1110s21c1
Sequence:CCGGCAGAAGGTGATCACATCAAAGCTCGAGCTTTGATGTGATCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-784s21c1
Sequence:CCGGGTAAACCTCGCTTGGACATCACTCGAGTGATGTCCAAGCGAGGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1338s21c1
Sequence:CCGGCATTGACTATTGTACTGAATGCTCGAGCATTCAGTACAATAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-626s21c1
Sequence:CCGGACCAAATGACCTTTGACAGTGCTCGAGCACTGTCAAAGGTCATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011695
VALIDATED
VDAC2 MISSION shRNA shRNA Plasmid DNA
voltage-dependent anion channel 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011695.1-348s1c1
Sequence:CCGGCAAGTACAAATGGTGTGAGTACTCGAGTACTCACACCATTTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011695.1-545s1c1
Sequence:CCGGGCTGTGATGTTGACTTTGATTCTCGAGAATCAAAGTCAACATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011695.1-444s1c1
Sequence:CCGGTCAAGGTTTGAAACTGACTTTCTCGAGAAAGTCAGTTTCAAACCTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1273s21c1
Sequence:CCGGATGATGAAATAGACGTTTATGCTCGAGCATAAACGTCTATTTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-264s21c1
Sequence:CCGGGACGAAGTCATGCAGCGGTGTCTCGAGACACCGCTGCATGACTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-385s21c1
Sequence:CCGGGAGAAGTGGAACACCGATAACCTCGAGGTTATCGGTGTTCCACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1302s21c1
Sequence:CCGGGCCATGGTGTGCATGTTTGTTCTCGAGAACAAACATGCACACCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1477s21c1
Sequence:CCGGATAACTAATGGCTCACGTATGCTCGAGCATACGTGAGCCATTAGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1110s21c1
Sequence:CCGGCAGAAGGTGATCACATCAAAGCTCGAGCTTTGATGTGATCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-784s21c1
Sequence:CCGGGTAAACCTCGCTTGGACATCACTCGAGTGATGTCCAAGCGAGGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1338s21c1
Sequence:CCGGCATTGACTATTGTACTGAATGCTCGAGCATTCAGTACAATAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-626s21c1
Sequence:CCGGACCAAATGACCTTTGACAGTGCTCGAGCACTGTCAAAGGTCATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011695
VALIDATED
VDAC2 MISSION shRNA Lentiviral Transduction Particles
voltage-dependent anion channel 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011695.1-348s1c1
Sequence:CCGGCAAGTACAAATGGTGTGAGTACTCGAGTACTCACACCATTTGTACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011695.1-545s1c1
Sequence:CCGGGCTGTGATGTTGACTTTGATTCTCGAGAATCAAAGTCAACATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011695.1-444s1c1
Sequence:CCGGTCAAGGTTTGAAACTGACTTTCTCGAGAAAGTCAGTTTCAAACCTTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1273s21c1
Sequence:CCGGATGATGAAATAGACGTTTATGCTCGAGCATAAACGTCTATTTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-264s21c1
Sequence:CCGGGACGAAGTCATGCAGCGGTGTCTCGAGACACCGCTGCATGACTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-385s21c1
Sequence:CCGGGAGAAGTGGAACACCGATAACCTCGAGGTTATCGGTGTTCCACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1302s21c1
Sequence:CCGGGCCATGGTGTGCATGTTTGTTCTCGAGAACAAACATGCACACCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1477s21c1
Sequence:CCGGATAACTAATGGCTCACGTATGCTCGAGCATACGTGAGCCATTAGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1110s21c1
Sequence:CCGGCAGAAGGTGATCACATCAAAGCTCGAGCTTTGATGTGATCACCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-784s21c1
Sequence:CCGGGTAAACCTCGCTTGGACATCACTCGAGTGATGTCCAAGCGAGGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011695.2-1338s21c1
Sequence:CCGGCATTGACTATTGTACTGAATGCTCGAGCATTCAGTACAATAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011695.2-626s21c1
Sequence:CCGGACCAAATGACCTTTGACAGTGCTCGAGCACTGTCAAAGGTCATTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003375
VDAC2 MISSION shRNA Bacterial Glycerol Stock
voltage-dependent anion channel 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003375.2-659s1c1
Sequence:CCGGCCTTTGACAGTGCCAAATCAACTCGAGTTGATTTGGCACTGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003375.2-726s1c1
Sequence:CCGGCCAGCTACACACTAATGTCAACTCGAGTTGACATTAGTGTGTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003375.2-1158s1c1
Sequence:CCGGGATCTCAACAAGAGCTGTATTCTCGAGAATACAGCTCTTGTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003375.2-856s1c1
Sequence:CCGGGCAGCTAAATATCAGTTGGATCTCGAGATCCAACTGATATTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003375.2-1292s1c1
Sequence:CCGGGCTACCCACCAATAATGAAATCTCGAGATTTCATTATTGGTGGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003375.2-1049s1c1
Sequence:CCGGGCTGAAAGAAACCTTTGGGAACTCGAGTTCCCAAAGGTTTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003375.2-878s1c1
Sequence:CCGGCCACTGCTTCCATTTCTGCAACTCGAGTTGCAGAAATGGAAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-316s21c1
Sequence:CCGGTCAACGTCCGGTTCATCTAATCTCGAGATTAGATGAACCGGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-446s21c1
Sequence:CCGGTCGCAATTGAAGACCAGATTTCTCGAGAAATCTGGTCTTCAATTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-754s21c1
Sequence:CCGGACAGAATTTGGAGGATCAATTCTCGAGAATTGATCCTCCAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-224s21c1
Sequence:CCGGGCAAAGCTGCCAGAGATATTTCTCGAGAAATATCTCTGGCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003375.2-1248s21c1
Sequence:CCGGGCAGTCACCTATACATTATTTCTCGAGAAATAATGTATAGGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-914s21c1
Sequence:CCGGGCTTAATTGGAGTAGGCTATACTCGAGTATAGCCTACTCCAATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003375.2-1212s21c1
Sequence:CCGGTCTAGTTGGTTATCTAGTTACCTCGAGGTAACTAGATAACCAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-1025s21c1
Sequence:CCGGCCCTGGAGTTGGAGGCTTAATCTCGAGATTAAGCCTCCAACTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003375
VDAC2 MISSION shRNA shRNA Plasmid DNA
voltage-dependent anion channel 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003375.2-659s1c1
Sequence:CCGGCCTTTGACAGTGCCAAATCAACTCGAGTTGATTTGGCACTGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003375.2-726s1c1
Sequence:CCGGCCAGCTACACACTAATGTCAACTCGAGTTGACATTAGTGTGTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003375.2-1158s1c1
Sequence:CCGGGATCTCAACAAGAGCTGTATTCTCGAGAATACAGCTCTTGTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003375.2-856s1c1
Sequence:CCGGGCAGCTAAATATCAGTTGGATCTCGAGATCCAACTGATATTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003375.2-1292s1c1
Sequence:CCGGGCTACCCACCAATAATGAAATCTCGAGATTTCATTATTGGTGGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003375.2-1049s1c1
Sequence:CCGGGCTGAAAGAAACCTTTGGGAACTCGAGTTCCCAAAGGTTTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003375.2-878s1c1
Sequence:CCGGCCACTGCTTCCATTTCTGCAACTCGAGTTGCAGAAATGGAAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-316s21c1
Sequence:CCGGTCAACGTCCGGTTCATCTAATCTCGAGATTAGATGAACCGGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-446s21c1
Sequence:CCGGTCGCAATTGAAGACCAGATTTCTCGAGAAATCTGGTCTTCAATTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-754s21c1
Sequence:CCGGACAGAATTTGGAGGATCAATTCTCGAGAATTGATCCTCCAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-224s21c1
Sequence:CCGGGCAAAGCTGCCAGAGATATTTCTCGAGAAATATCTCTGGCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003375.2-1248s21c1
Sequence:CCGGGCAGTCACCTATACATTATTTCTCGAGAAATAATGTATAGGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-914s21c1
Sequence:CCGGGCTTAATTGGAGTAGGCTATACTCGAGTATAGCCTACTCCAATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003375.2-1212s21c1
Sequence:CCGGTCTAGTTGGTTATCTAGTTACCTCGAGGTAACTAGATAACCAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-1025s21c1
Sequence:CCGGCCCTGGAGTTGGAGGCTTAATCTCGAGATTAAGCCTCCAACTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003375
VDAC2 MISSION shRNA Lentiviral Transduction Particles
voltage-dependent anion channel 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003375.2-659s1c1
Sequence:CCGGCCTTTGACAGTGCCAAATCAACTCGAGTTGATTTGGCACTGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003375.2-726s1c1
Sequence:CCGGCCAGCTACACACTAATGTCAACTCGAGTTGACATTAGTGTGTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003375.2-1158s1c1
Sequence:CCGGGATCTCAACAAGAGCTGTATTCTCGAGAATACAGCTCTTGTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003375.2-856s1c1
Sequence:CCGGGCAGCTAAATATCAGTTGGATCTCGAGATCCAACTGATATTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003375.2-1292s1c1
Sequence:CCGGGCTACCCACCAATAATGAAATCTCGAGATTTCATTATTGGTGGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003375.2-1049s1c1
Sequence:CCGGGCTGAAAGAAACCTTTGGGAACTCGAGTTCCCAAAGGTTTCTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003375.2-878s1c1
Sequence:CCGGCCACTGCTTCCATTTCTGCAACTCGAGTTGCAGAAATGGAAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-316s21c1
Sequence:CCGGTCAACGTCCGGTTCATCTAATCTCGAGATTAGATGAACCGGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-446s21c1
Sequence:CCGGTCGCAATTGAAGACCAGATTTCTCGAGAAATCTGGTCTTCAATTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-754s21c1
Sequence:CCGGACAGAATTTGGAGGATCAATTCTCGAGAATTGATCCTCCAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-224s21c1
Sequence:CCGGGCAAAGCTGCCAGAGATATTTCTCGAGAAATATCTCTGGCAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003375.2-1248s21c1
Sequence:CCGGGCAGTCACCTATACATTATTTCTCGAGAAATAATGTATAGGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-914s21c1
Sequence:CCGGGCTTAATTGGAGTAGGCTATACTCGAGTATAGCCTACTCCAATTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003375.2-1212s21c1
Sequence:CCGGTCTAGTTGGTTATCTAGTTACCTCGAGGTAACTAGATAACCAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003375.2-1025s21c1
Sequence:CCGGCCCTGGAGTTGGAGGCTTAATCTCGAGATTAAGCCTCCAACTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks