EMAIL THIS PAGE TO A FRIEND

VDAC3

voltage-dependent anion channel 3

Synonyms: HD-VDAC3 VDAC-3
UniProtKB ID: Q9Y277, Q9UIS0
Gene ID:
Human(7419) Summary: This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(22335) voltage-dependent anion channel 3
Rat(83532) voltage-dependent anion channel 3
Thale Cress(831361) voltage dependent anion channel 3
domestic cat(101099117) voltage-dependent anion channel 3
dog(606963) voltage-dependent anion channel 3
Zebrafish(406529) voltage-dependent anion channel 3
chicken(426793) voltage-dependent anion channel 3
domestic guinea pig(100728777) voltage-dependent anion channel 3
Domestic Rabbit(100008752) voltage-dependent anion channel 3
naked mole-rat(101709540) voltage-dependent anion channel 3
cow(282716) voltage-dependent anion channel 3
Goat(100861099) voltage-dependent anion channel 3
sheep(101118850) voltage-dependent anion channel 3
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108497 Anti-VDAC3 affinity isolated antibody mouse, canine, human, goat, rabbit, bovine, horse, rat, zebrafish, pig, guinea pig
immunohistochemistry, western blot pricing
AV35180 Anti-VDAC3 antibody produced in rabbit affinity isolated antibody rabbit, zebrafish, pig, bovine, human, guinea pig, canine, mouse, rabbit, rat, horse
western blot pricing
HPA026864 Anti-VDAC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103490 Anti-VDAC3, (N-terminal) antibody produced in rabbit affinity isolated antibody canine, guinea pig, horse, pig, rat, rabbit, human, bovine, mouse, rabbit, zebrafish,
western blot pricing
SAB1401398 Monoclonal Anti-VDAC3 antibody produced in mouse clone 1C6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0302 AQUA Peptide VGLG[F]ELEA African clawed frog, chicken, cow, dog, human, mouse, pig, rat pricing
AQ0296 AQUA Peptide LTLSALVDG[K] African clawed frog, cow, dog, human, mouse, pig, rat pricing
AQ0303 AQUA Peptide VNNASLIGLGYTQSLRPGV[K] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005662 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005662 Rosetta Predictions human pricing
NM_031355 Rosetta Predictions rat pricing
NM_011696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340036 predicted 384
2 SASI_Hs01_00199683 predicted 856
3 SASI_Hs02_00340037 predicted 294
4 SASI_Hs01_00199674 predicted 779
5 SASI_Hs01_00199675 predicted 472
6 SASI_Hs02_00340038 predicted 575
7 SASI_Hs01_00199677 predicted 654
8 SASI_Hs02_00340039 predicted 936
9 SASI_Hs01_00199678 predicted 221
10 SASI_Hs02_00340040 predicted 680
11 SASI_Hs01_00199676 predicted 976
12 SASI_Hs01_00199679 predicted 332
13 SASI_Hs01_00199680 predicted 353
14 SASI_Hs01_00199681 predicted 994
15 SASI_Hs01_00199682 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031355 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264609 predicted 769
2 SASI_Rn01_00032781 predicted 262
3 SASI_Rn01_00032782 predicted 378
4 SASI_Rn01_00032783 predicted 810
5 SASI_Rn02_00264610 predicted 765
6 SASI_Rn01_00032784 predicted 211
7 SASI_Rn01_00032785 predicted 614
8 SASI_Rn01_00032787 predicted 277
9 SASI_Rn02_00264611 predicted 953
10 SASI_Rn01_00032789 predicted 572
11 SASI_Rn01_00032786 predicted 282
12 SASI_Rn01_00032788 predicted 795
13 SASI_Rn01_00032790 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110002 predicted 670
2 SASI_Mm01_00110003 predicted 211
3 SASI_Mm02_00321255 predicted 855
4 SASI_Mm01_00110004 predicted 254
5 SASI_Mm01_00110005 predicted 649
6 SASI_Mm01_00110007 predicted 736
7 SASI_Mm01_00110008 predicted 779
8 SASI_Mm01_00110009 predicted 969
9 SASI_Mm01_00110010 predicted 555
10 SASI_Mm01_00110011 predicted 359
11 SASI_Mm01_00110006 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011696
VALIDATED
VDAC3 MISSION shRNA Bacterial Glycerol Stock
voltage-dependent anion channel 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-243s21c1
Sequence:CCGGGGCAACCTAGAGACCAAATATCTCGAGATATTTGGTCTCTAGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-613s21c1
Sequence:CCGGAGCTGCATACTCACGTGAATGCTCGAGCATTCACGTGAGTATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-1149s21c1
Sequence:CCGGTTGAGTTCTGCAGAGTTAATTCTCGAGAATTAACTCTGCAGAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-450s21c1
Sequence:CCGGCTCGGCAGTAATGTTGATATACTCGAGTATATCAACATTACTGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-367s21c1
Sequence:CCGGTGACTCTTGATACCATATTTGCTCGAGCAAATATGGTATCAAGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-781s1c1
Sequence:CCGGCCAAAGTAAACAATGCCAGTTCTCGAGAACTGGCATTGTTTACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-123s1c1
Sequence:CCGGGATGTCTTTAACAAAGGGTATCTCGAGATACCCTTTGTTAAAGACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-674s1c1
Sequence:CCGGCGAGAGGATTGAAACGTCAATCTCGAGATTGACGTTTCAATCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-216s1c1
Sequence:CCGGGCTTATACTGATACAGGGAAACTCGAGTTTCCCTGTATCAGTATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011696.1-1185s1c1
Sequence:CCGGGCAACAACGTAGTGTCATGTTCTCGAGAACATGACACTACGTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011696
VALIDATED
VDAC3 MISSION shRNA shRNA Plasmid DNA
voltage-dependent anion channel 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-243s21c1
Sequence:CCGGGGCAACCTAGAGACCAAATATCTCGAGATATTTGGTCTCTAGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-613s21c1
Sequence:CCGGAGCTGCATACTCACGTGAATGCTCGAGCATTCACGTGAGTATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-1149s21c1
Sequence:CCGGTTGAGTTCTGCAGAGTTAATTCTCGAGAATTAACTCTGCAGAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-450s21c1
Sequence:CCGGCTCGGCAGTAATGTTGATATACTCGAGTATATCAACATTACTGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-367s21c1
Sequence:CCGGTGACTCTTGATACCATATTTGCTCGAGCAAATATGGTATCAAGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-781s1c1
Sequence:CCGGCCAAAGTAAACAATGCCAGTTCTCGAGAACTGGCATTGTTTACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-123s1c1
Sequence:CCGGGATGTCTTTAACAAAGGGTATCTCGAGATACCCTTTGTTAAAGACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-674s1c1
Sequence:CCGGCGAGAGGATTGAAACGTCAATCTCGAGATTGACGTTTCAATCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-216s1c1
Sequence:CCGGGCTTATACTGATACAGGGAAACTCGAGTTTCCCTGTATCAGTATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011696.1-1185s1c1
Sequence:CCGGGCAACAACGTAGTGTCATGTTCTCGAGAACATGACACTACGTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011696
VALIDATED
VDAC3 MISSION shRNA Lentiviral Transduction Particles
voltage-dependent anion channel 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-243s21c1
Sequence:CCGGGGCAACCTAGAGACCAAATATCTCGAGATATTTGGTCTCTAGGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-613s21c1
Sequence:CCGGAGCTGCATACTCACGTGAATGCTCGAGCATTCACGTGAGTATGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-1149s21c1
Sequence:CCGGTTGAGTTCTGCAGAGTTAATTCTCGAGAATTAACTCTGCAGAACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-450s21c1
Sequence:CCGGCTCGGCAGTAATGTTGATATACTCGAGTATATCAACATTACTGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011696.1-367s21c1
Sequence:CCGGTGACTCTTGATACCATATTTGCTCGAGCAAATATGGTATCAAGAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-781s1c1
Sequence:CCGGCCAAAGTAAACAATGCCAGTTCTCGAGAACTGGCATTGTTTACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-123s1c1
Sequence:CCGGGATGTCTTTAACAAAGGGTATCTCGAGATACCCTTTGTTAAAGACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-674s1c1
Sequence:CCGGCGAGAGGATTGAAACGTCAATCTCGAGATTGACGTTTCAATCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011696.1-216s1c1
Sequence:CCGGGCTTATACTGATACAGGGAAACTCGAGTTTCCCTGTATCAGTATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011696.1-1185s1c1
Sequence:CCGGGCAACAACGTAGTGTCATGTTCTCGAGAACATGACACTACGTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005662
VALIDATED
VDAC3 MISSION shRNA Bacterial Glycerol Stock
voltage-dependent anion channel 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-990s1c1
Sequence:CCGGGAAGAGAAATGAACCCACTATCTCGAGATAGTGGGTTCATTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-856s1c1
Sequence:CCGGCCAGGAGTCAAATTGACTTTACTCGAGTAAAGTCAATTTGACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-579s1c1
Sequence:CCGGCAAATCCAAACTGTCACAGAACTCGAGTTCTGTGACAGTTTGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-808s1c1
Sequence:CCGGGTAAATAATGCCAGCCTGATTCTCGAGAATCAGGCTGGCATTATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-777s1c1
Sequence:CCGGGCTGGATTGTAGAACTTCTCTCTCGAGAGAGAAGTTCTACAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005662.3-1221s1c1
Sequence:CCGGCGTCATGTTAGAGGAGACGATCTCGAGATCGTCTCCTCTAACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-1210s1c1
Sequence:CCGGCGACAGTGTAGCGTCATGTTACTCGAGTAACATGACGCTACACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-763s1c1
Sequence:CCGGGCTGCTAAGTACATGCTGGATCTCGAGATCCAGCATGTACTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-445s1c1
Sequence:CCGGGCCTCCTATAAACGGGATTGTCTCGAGACAATCCCGTTTATAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-263s1c1
Sequence:CCGGCAGGCAACCTAGAAACCAAATCTCGAGATTTGGTTTCTAGGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005662
VALIDATED
VDAC3 MISSION shRNA shRNA Plasmid DNA
voltage-dependent anion channel 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-990s1c1
Sequence:CCGGGAAGAGAAATGAACCCACTATCTCGAGATAGTGGGTTCATTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-856s1c1
Sequence:CCGGCCAGGAGTCAAATTGACTTTACTCGAGTAAAGTCAATTTGACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-579s1c1
Sequence:CCGGCAAATCCAAACTGTCACAGAACTCGAGTTCTGTGACAGTTTGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-808s1c1
Sequence:CCGGGTAAATAATGCCAGCCTGATTCTCGAGAATCAGGCTGGCATTATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-777s1c1
Sequence:CCGGGCTGGATTGTAGAACTTCTCTCTCGAGAGAGAAGTTCTACAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005662.3-1221s1c1
Sequence:CCGGCGTCATGTTAGAGGAGACGATCTCGAGATCGTCTCCTCTAACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-1210s1c1
Sequence:CCGGCGACAGTGTAGCGTCATGTTACTCGAGTAACATGACGCTACACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-763s1c1
Sequence:CCGGGCTGCTAAGTACATGCTGGATCTCGAGATCCAGCATGTACTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-445s1c1
Sequence:CCGGGCCTCCTATAAACGGGATTGTCTCGAGACAATCCCGTTTATAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-263s1c1
Sequence:CCGGCAGGCAACCTAGAAACCAAATCTCGAGATTTGGTTTCTAGGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005662
VALIDATED
VDAC3 MISSION shRNA Lentiviral Transduction Particles
voltage-dependent anion channel 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-990s1c1
Sequence:CCGGGAAGAGAAATGAACCCACTATCTCGAGATAGTGGGTTCATTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-856s1c1
Sequence:CCGGCCAGGAGTCAAATTGACTTTACTCGAGTAAAGTCAATTTGACTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-579s1c1
Sequence:CCGGCAAATCCAAACTGTCACAGAACTCGAGTTCTGTGACAGTTTGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-808s1c1
Sequence:CCGGGTAAATAATGCCAGCCTGATTCTCGAGAATCAGGCTGGCATTATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-777s1c1
Sequence:CCGGGCTGGATTGTAGAACTTCTCTCTCGAGAGAGAAGTTCTACAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005662.3-1221s1c1
Sequence:CCGGCGTCATGTTAGAGGAGACGATCTCGAGATCGTCTCCTCTAACATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139639    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-1210s1c1
Sequence:CCGGCGACAGTGTAGCGTCATGTTACTCGAGTAACATGACGCTACACTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005662.3-763s1c1
Sequence:CCGGGCTGCTAAGTACATGCTGGATCTCGAGATCCAGCATGTACTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-445s1c1
Sequence:CCGGGCCTCCTATAAACGGGATTGTCTCGAGACAATCCCGTTTATAGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005662.3-263s1c1
Sequence:CCGGCAGGCAACCTAGAAACCAAATCTCGAGATTTGGTTTCTAGGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks