EMAIL THIS PAGE TO A FRIEND

VDR

vitamin D (1,25- dihydroxyvitamin D3) receptor

Synonyms: NR1I1
UniProtKB ID: P11473, B2R5Q1, G3V1V9, Q5PSV3
Gene ID:
Human(7421) Summary: This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
Mouse(22337) vitamin D receptor
Rat(24873) vitamin D (1,25- dihydroxyvitamin D3) receptor
chicken(395988) vitamin D (1,25- dihydroxyvitamin D3) receptor
dog(486588) vitamin D (1,25- dihydroxyvitamin D3) receptor
Horse(100034072) vitamin D (1,25- dihydroxyvitamin D3) receptor
domestic cat(100316614) vitamin D (1,25- dihydroxyvitamin D3) receptor
cow(533656) vitamin D (1,25- dihydroxyvitamin D3) receptor
sheep(101107273) vitamin D (1,25- dihydroxyvitamin D3) receptor
sheep(100294603) vitamin D (1,25- dihydroxyvitamin D3) receptor
naked mole-rat(101710294) vitamin D (1,25- dihydroxyvitamin D3) receptor
domestic guinea pig(100734655) vitamin D (1,25- dihydroxyvitamin D3) receptor
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504326 Anti-phospho-Vitamin D Receptor (pSer208) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301490 Anti-phospho-Vitamin D Receptor (pSer208) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2108738 Anti-VDR affinity isolated antibody canine, rabbit, bovine, pig, mouse, horse, guinea pig, rat, rat
western blot pricing
SAB2102673 Anti-VDR (ab1) antibody produced in rabbit affinity isolated antibody human, guinea pig, pig, mouse, rabbit, horse, bovine, rat
western blot pricing
SAB2102674 Anti-VDR (ab2) antibody produced in rabbit affinity isolated antibody rat, bovine, horse, zebrafish, rabbit, pig, human, rabbit, mouse
western blot pricing
SAB2501098 Anti-VDR antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1406580 Anti-VDR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA047740 Anti-VDR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2104917 Anti-VDR, (N-terminal) antibody produced in rabbit affinity isolated antibody human, mouse, horse, guinea pig, rabbit, rat
western blot pricing
SAB4503071 Anti-Vitamin D Receptor antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4503072 Anti-Vitamin D3 Receptor, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
WH0007421M2 Monoclonal Anti-VDR antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
D1530 1α,25-Dihydroxyvitamin D3 ≥99% (HPLC) human pricing
17936 1α,25-Dihydroxyvitamin D3 ≥97.0% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000376 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010441 MISSION® esiRNA esiRNA targeting human VDR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000376 Rosetta Predictions human pricing
NM_001017535 Rosetta Predictions human pricing
NM_017058 Rosetta Predictions rat pricing
NM_009504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068008 predicted 767
2 SASI_Hs01_00068009 predicted 964
3 SASI_Hs01_00068010 predicted 463
4 SASI_Hs01_00068011 predicted 1427
5 SASI_Hs01_00068012 predicted 1114
6 SASI_Hs02_00302434 predicted 770
7 SASI_Hs01_00068013 predicted 1578
8 SASI_Hs01_00068014 predicted 391
9 SASI_Hs01_00068015 predicted 291
10 SASI_Hs02_00302435 predicted 896
11 SASI_Hs01_00068007 predicted 317
12 SASI_Hs01_00068016 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167284 predicted 885
2 SASI_Hs01_00167285 predicted 1081
3 SASI_Hs01_00167286 predicted 589
4 SASI_Hs01_00167287 predicted 1548
5 SASI_Hs01_00167288 predicted 1234
6 SASI_Hs02_00306796 predicted 897
7 SASI_Hs01_00167289 predicted 1704
8 SASI_Hs01_00167290 predicted 518
9 SASI_Hs01_00167291 predicted 416
10 SASI_Hs02_00306797 predicted 1012
11 SASI_Hs01_00167283 predicted 436
12 SASI_Hs01_00167292 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048362 predicted 397
2 SASI_Rn01_00048363 predicted 850
3 SASI_Rn01_00048364 predicted 567
4 SASI_Rn01_00048365 predicted 913
5 SASI_Rn01_00048367 predicted 872
6 SASI_Rn01_00048368 predicted 886
7 SASI_Rn01_00048369 predicted 809
8 SASI_Rn01_00048370 predicted 703
9 SASI_Rn01_00048371 predicted 861
10 SASI_Rn02_00261248 predicted 237
11 SASI_Rn01_00048366 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067274 predicted 896
2 SASI_Mm01_00067275 predicted 604
3 SASI_Mm01_00067276 predicted 380
4 SASI_Mm01_00067277 predicted 325
5 SASI_Mm01_00067278 predicted 924
6 SASI_Mm01_00067279 predicted 617
7 SASI_Mm01_00067280 predicted 1298
8 SASI_Mm01_00067281 predicted 244
9 SASI_Mm01_00067282 predicted 927
10 SASI_Mm01_00067283 predicted 899
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009504
VALIDATED
VDR MISSION shRNA Bacterial Glycerol Stock
vitamin D (1,25- dihydroxyvitamin D3) receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-813s1c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-675s1c1
Sequence:CCGGCTCCTCAAACTCTGATCTGTACTCGAGTACAGATCAGAGTTTGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-393s1c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-3062s1c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-996s1c1
Sequence:CCGGCCAAGACTACAAATATGACATCTCGAGATGTCATATTTGTAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-620s21c1
Sequence:CCGGCGTAAGTACAGGGAGCTATTCCTCGAGGAATAGCTCCCTGTACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-812s21c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-3061s21c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-392s21c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009504
VALIDATED
VDR MISSION shRNA shRNA Plasmid DNA
vitamin D (1,25- dihydroxyvitamin D3) receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-813s1c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-675s1c1
Sequence:CCGGCTCCTCAAACTCTGATCTGTACTCGAGTACAGATCAGAGTTTGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-393s1c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-3062s1c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-996s1c1
Sequence:CCGGCCAAGACTACAAATATGACATCTCGAGATGTCATATTTGTAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-620s21c1
Sequence:CCGGCGTAAGTACAGGGAGCTATTCCTCGAGGAATAGCTCCCTGTACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-812s21c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-3061s21c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-392s21c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009504
VALIDATED
VDR MISSION shRNA Lentiviral Transduction Particles
vitamin D (1,25- dihydroxyvitamin D3) receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-813s1c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-675s1c1
Sequence:CCGGCTCCTCAAACTCTGATCTGTACTCGAGTACAGATCAGAGTTTGAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-393s1c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009504.2-3062s1c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009504.2-996s1c1
Sequence:CCGGCCAAGACTACAAATATGACATCTCGAGATGTCATATTTGTAGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-620s21c1
Sequence:CCGGCGTAAGTACAGGGAGCTATTCCTCGAGGAATAGCTCCCTGTACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-812s21c1
Sequence:CCGGCCTGGCTGATCTTGTCAGTTACTCGAGTAACTGACAAGATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328259    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-3061s21c1
Sequence:CCGGCCTGAGATCAATCACATTTAACTCGAGTTAAATGTGATTGATCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009504.3-392s21c1
Sequence:CCGGCGTGGACATTGGCATGATGAACTCGAGTTCATCATGCCAATGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000376
VALIDATED
VDR MISSION shRNA Bacterial Glycerol Stock
vitamin D (1,25- dihydroxyvitamin D3) receptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-1001s1c1
Sequence:CCGGCGCGTCAGTGACGTGACCAAACTCGAGTTTGGTCACGTCACTGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-151s1c1
Sequence:CCGGCCCTGGAGACTTTGACCGGAACTCGAGTTCCGGTCAAAGTCTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-578s1c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-923s1c1
Sequence:CCGGGTCATCATGTTGCGCTCCAATCTCGAGATTGGAGCGCAACATGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-1372s1c1
Sequence:CCGGCGAAGTGTTTGGCAATGAGATCTCGAGATCTCATTGCCAAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-885s21c1
Sequence:CCGGTTGGCTTTGCTAAGATGATACCTCGAGGTATCATCTTAGCAAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-1878s21c1
Sequence:CCGGCTCCTGCCTACTCACGATAAACTCGAGTTTATCGTGAGTAGGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-623s21c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000376.2-713s21c1
Sequence:CCGGTCCTGCTCAGATCACTGTATCCTCGAGGATACAGTGATCTGAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-314s21c1
Sequence:CCGGATGAAGCGGAAGGCACTATTCCTCGAGGAATAGTGCCTTCCGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000376
VALIDATED
VDR MISSION shRNA shRNA Plasmid DNA
vitamin D (1,25- dihydroxyvitamin D3) receptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-1001s1c1
Sequence:CCGGCGCGTCAGTGACGTGACCAAACTCGAGTTTGGTCACGTCACTGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-151s1c1
Sequence:CCGGCCCTGGAGACTTTGACCGGAACTCGAGTTCCGGTCAAAGTCTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-578s1c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-923s1c1
Sequence:CCGGGTCATCATGTTGCGCTCCAATCTCGAGATTGGAGCGCAACATGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-1372s1c1
Sequence:CCGGCGAAGTGTTTGGCAATGAGATCTCGAGATCTCATTGCCAAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-885s21c1
Sequence:CCGGTTGGCTTTGCTAAGATGATACCTCGAGGTATCATCTTAGCAAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-1878s21c1
Sequence:CCGGCTCCTGCCTACTCACGATAAACTCGAGTTTATCGTGAGTAGGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-623s21c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000376.2-713s21c1
Sequence:CCGGTCCTGCTCAGATCACTGTATCCTCGAGGATACAGTGATCTGAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-314s21c1
Sequence:CCGGATGAAGCGGAAGGCACTATTCCTCGAGGAATAGTGCCTTCCGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000376
VALIDATED
VDR MISSION shRNA Lentiviral Transduction Particles
vitamin D (1,25- dihydroxyvitamin D3) receptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-1001s1c1
Sequence:CCGGCGCGTCAGTGACGTGACCAAACTCGAGTTTGGTCACGTCACTGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000376.1-151s1c1
Sequence:CCGGCCCTGGAGACTTTGACCGGAACTCGAGTTCCGGTCAAAGTCTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-578s1c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-923s1c1
Sequence:CCGGGTCATCATGTTGCGCTCCAATCTCGAGATTGGAGCGCAACATGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000376.1-1372s1c1
Sequence:CCGGCGAAGTGTTTGGCAATGAGATCTCGAGATCTCATTGCCAAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-885s21c1
Sequence:CCGGTTGGCTTTGCTAAGATGATACCTCGAGGTATCATCTTAGCAAAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-1878s21c1
Sequence:CCGGCTCCTGCCTACTCACGATAAACTCGAGTTTATCGTGAGTAGGCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-623s21c1
Sequence:CCGGCCTCCAGTTCGTGTGAATGATCTCGAGATCATTCACACGAACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000376.2-713s21c1
Sequence:CCGGTCCTGCTCAGATCACTGTATCCTCGAGGATACAGTGATCTGAGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000376.2-314s21c1
Sequence:CCGGATGAAGCGGAAGGCACTATTCCTCGAGGAATAGTGCCTTCCGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks