EMAIL THIS PAGE TO A FRIEND

VEGFA

vascular endothelial growth factor A

Synonyms: MVCD1 VEGF VPF
Gene ID:
Human(7422) Summary: This gene is a member of the PDGF/VEGF growth factor family and encodes a protein that is often found as a disulfide linked homodimer. This protein is a glycosylated mitogen that specifically acts on endothelial cells and has various effects, including mediating increased vascular permeability, inducing angiogenesis, vasculogenesis and endothelial cell growth, promoting cell migration, and inhibiting apoptosis. Elevated levels of this protein is linked to POEMS syndrome, also known as Crow-Fukase syndrome. Mutations in this gene have been associated with proliferative and nonproliferative diabetic retinopathy. Alternatively spliced transcript variants, encoding either freely secreted or cell-associated isoforms, have been characterized. There is also evidence for the use of non-AUG (CUG) translation initiation sites upstream of, and in-frame with the first AUG, leading to additional isoforms. [provided by RefSeq, Jul 2008]
Mouse(22339) vascular endothelial growth factor A
Rat(83785) vascular endothelial growth factor A
chicken(395909) vascular endothelial growth factor A
dog(403802) vascular endothelial growth factor A
domestic cat(493845) vascular endothelial growth factor A
Horse(100033839) vascular endothelial growth factor A
cow(281572) vascular endothelial growth factor A
Goat(100860957) vascular endothelial growth factor A
sheep(443103) vascular endothelial growth factor A
domestic guinea pig(100462897) vascular endothelial growth factor A
domestic guinea pig(100713483) vascular endothelial growth factor A
naked mole-rat(101702403) vascular endothelial growth factor A
Domestic Rabbit(100008899) vascular endothelial growth factor A
Gene Class: Apoptosis
399 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
V6627 Anti-Vascular Endothelial Growth Factor antibody produced in goat IgG fraction of antiserum, lyophilized powder human
immunohistochemistry, neutralization, western blot pricing
V1253 Anti-Vascular Endothelial Growth Factor antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, immunohistochemistry, neutralization, western blot pricing
GW21180 Anti-VEGF antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1306008 ANTI-VEGF1(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2502119 Anti-VEGFA antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, pig
ELISA, western blot pricing
HPA069116 Anti-VEGFA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
V4758 Monoclonal Anti-Vascular Endothelial Growth Factor antibody produced in mouse clone 26503, purified immunoglobulin, lyophilized powder human, primate
ELISA, immunohistochemistry, neutralization, western blot pricing
SAB3300042 Monoclonal Anti-VEGF antibody produced in mouse clone 4G3, purified immunoglobulin, buffered aqueous glycerol solution human
western blot pricing
SAB1402390 Monoclonal Anti-VEGF antibody produced in mouse clone 3F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T0318 Tranilast ≥98% (HPLC), powder human pricing

Proteins

Product # Description Species Add to Cart
 
APREST92843 PrEST Antigen VEGFA Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution New human pricing
QPREST23296 SILuPrEST VEGFA SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
V3388 Vascular Endothelial Growth Factor (aa 207-318) human ≥97% (SDS-PAGE), recombinant, expressed in E. coli, lyophilized powder human pricing
V7259 Vascular Endothelial Growth Factor human VEGF, recombinant, expressed in E. coli, powder, suitable for cell culture human pricing
SRP3182 VEGF human Animal-component free, recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC), cell culture tested human pricing
SRP4964 VEGF121 murine recombinant, expressed in E. coli, ≥97% (SDS-PAGE), ≥97% (HPLC) human pricing
SRP4363 VEGF165 human recombinant, expressed in E. coli, ≥98% (SDS-PAGE), ≥98% (HPLC) human pricing
V4512 Vascular Endothelial Growth Factor from mouse VEGF, recombinant, expressed in E. coli, powder, suitable for cell culture mouse pricing
SRP6429 VEGF120 from mouse recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE) mouse pricing
SRP6430 VEGF164 from mouse recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE) mouse pricing
SRP4364 VEGF165 from mouse recombinant, expressed in E. coli mouse pricing
V3638 Vascular Endothelial Growth Factor 164 from rat >95% (SDS-PAGE), recombinant, expressed in NSO cells, lyophilized powder rat pricing
SRP4365 VEGF165 from rat recombinant, expressed in E. coli, ≥98% (SDS-PAGE) rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025366 Rosetta Predictions human pricing
NM_001025367 Rosetta Predictions human pricing
NM_001025368 Rosetta Predictions human pricing
NM_001025369 Rosetta Predictions human pricing
NM_001025370 Rosetta Predictions human pricing
NM_001033756 Rosetta Predictions human pricing
NM_003376 Rosetta Predictions human pricing
NM_001110333 Rosetta Predictions rat pricing
NM_001110334 Rosetta Predictions rat pricing
NM_001110335 Rosetta Predictions rat pricing
NM_001110336 Rosetta Predictions rat pricing
NM_031836 Rosetta Predictions rat pricing
NM_001025250 Rosetta Predictions mouse pricing
NM_001025257 Rosetta Predictions mouse pricing
NM_001110266 Rosetta Predictions mouse pricing
NM_001110267 Rosetta Predictions mouse pricing
NM_001110268 Rosetta Predictions mouse pricing
NM_009505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201117 predicted 1146
2 SASI_Hs01_00201118 predicted 1019
3 SASI_Hs01_00201119 predicted 1229
4 SASI_Hs01_00201120 predicted 1124
5 SASI_Hs01_00201121 predicted 1225
6 SASI_Hs01_00201122 predicted 1172
7 SASI_Hs01_00201123 predicted 1627
8 SASI_Hs01_00201124 predicted 1504
9 SASI_Hs01_00201126 predicted 1238
10 SASI_Hs02_00307450 predicted 1841
11 SASI_Hs01_00201125 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204678 predicted 1145
2 SASI_Hs01_00204679 predicted 1014
3 SASI_Hs01_00204680 predicted 1230
4 SASI_Hs01_00204681 predicted 1126
5 SASI_Hs01_00204682 predicted 1221
6 SASI_Hs01_00204683 predicted 1169
7 SASI_Hs01_00204684 predicted 1557
8 SASI_Hs01_00204686 predicted 1235
9 SASI_Hs01_00204687 predicted 1774
10 SASI_Hs02_00307451 predicted 1528
11 SASI_Hs01_00204685 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128211 predicted 1147
2 SASI_Hs01_00128212 predicted 1016
3 SASI_Hs01_00128213 predicted 1225
4 SASI_Hs01_00128214 predicted 1131
5 SASI_Hs01_00128215 predicted 1223
6 SASI_Hs01_00128216 predicted 1171
7 SASI_Hs01_00128217 predicted 1504
8 SASI_Hs01_00128219 predicted 1235
9 SASI_Hs01_00128220 predicted 1725
10 SASI_Hs02_00307452 predicted 1476
11 SASI_Hs01_00128218 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177589 predicted 1153
2 SASI_Hs01_00177590 predicted 1020
3 SASI_Hs01_00177591 predicted 1230
4 SASI_Hs01_00177592 predicted 1127
5 SASI_Hs01_00177593 predicted 1222
6 SASI_Hs01_00177594 predicted 1173
7 SASI_Hs02_00307453 predicted 1508
8 SASI_Hs01_00177596 predicted 1233
9 SASI_Hs01_00177597 predicted 1692
10 SASI_Hs01_00177598 predicted 1483
11 SASI_Hs01_00177595 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105247 predicted 1146
2 SASI_Hs01_00105248 predicted 1014
3 SASI_Hs01_00105249 predicted 1224
4 SASI_Hs01_00105250 predicted 1122
5 SASI_Hs01_00105251 predicted 1225
6 SASI_Hs01_00105252 predicted 1169
7 SASI_Hs01_00105253 predicted 1385
8 SASI_Hs02_00307454 predicted 1932
9 SASI_Hs01_00105254 predicted 1231
10 SASI_Hs01_00105255 predicted 1594
11 SASI_Hs01_00105256 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096324 predicted 1147
2 SASI_Hs01_00096325 predicted 1020
3 SASI_Hs01_00096326 predicted 1229
4 SASI_Hs01_00096327 predicted 1129
5 SASI_Hs01_00096328 predicted 1217
6 SASI_Hs01_00096329 predicted 1167
7 SASI_Hs01_00096330 predicted 1503
8 SASI_Hs01_00096331 predicted 1390
9 SASI_Hs01_00096332 predicted 1233
10 SASI_Hs01_00096333 predicted 1660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037489 predicted 1151
2 SASI_Hs01_00037490 predicted 1018
3 SASI_Hs01_00037491 predicted 1227
4 SASI_Hs01_00037492 predicted 1124
5 SASI_Hs01_00037493 predicted 1222
6 SASI_Hs01_00037494 predicted 1172
7 SASI_Hs01_00037495 predicted 1579
8 SASI_Hs01_00037497 predicted 1231
9 SASI_Hs01_00037498 predicted 1794
10 SASI_Hs02_00335539 predicted 1555
11 SASI_Hs01_00037496 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251142 predicted 1151
2 SASI_Rn02_00251143 predicted 1481
3 SASI_Rn02_00251144 predicted 1451
4 SASI_Rn02_00251145 predicted 1206
5 SASI_Rn02_00251146 predicted 1311
6 SASI_Rn02_00251147 predicted 1474
7 SASI_Rn02_00251148 predicted 1554
8 SASI_Rn02_00251149 predicted 1685
9 SASI_Rn02_00251150 predicted 1154
10 SASI_Rn02_00251151 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251152 predicted 1154
2 SASI_Rn02_00251153 predicted 1903
3 SASI_Rn02_00251154 predicted 1209
4 SASI_Rn02_00251155 predicted 1318
5 SASI_Rn02_00251156 predicted 1551
6 SASI_Rn02_00251157 predicted 1154
7 SASI_Rn02_00251158 predicted 1209
8 SASI_Rn02_00251159 predicted 1882
9 SASI_Rn02_00251160 predicted 1374
10 SASI_Rn02_00251161 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251162 predicted 568
2 SASI_Rn02_00251163 predicted 903
3 SASI_Rn02_00251164 predicted 755
4 SASI_Rn02_00251165 predicted 1205
5 SASI_Rn02_00251166 predicted 764
6 SASI_Rn02_00251167 predicted 534
7 SASI_Rn02_00251168 predicted 522
8 SASI_Rn02_00251169 predicted 806
9 SASI_Rn02_00251170 predicted 595
10 SASI_Rn02_00251171 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251172 predicted 496
2 SASI_Rn02_00251173 predicted 836
3 SASI_Rn02_00251174 predicted 686
4 SASI_Rn02_00251175 predicted 1135
5 SASI_Rn02_00251176 predicted 540
6 SASI_Rn02_00251177 predicted 689
7 SASI_Rn02_00251178 predicted 732
8 SASI_Rn02_00251179 predicted 530
9 SASI_Rn02_00251180 predicted 600
10 SASI_Rn02_00251181 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094521 predicted 1148
2 SASI_Rn01_00094523 predicted 1483
3 SASI_Rn01_00094524 predicted 1471
4 SASI_Rn01_00094526 predicted 1212
5 SASI_Rn01_00094527 predicted 1312
6 SASI_Rn01_00094528 predicted 1544
7 SASI_Rn01_00094529 predicted 1626
8 SASI_Rn02_00265319 predicted 1760
9 SASI_Rn02_00265320 predicted 1158
10 SASI_Rn01_00094530 predicted 1214
11 SASI_Rn01_00094522 predicted 500
12 SASI_Rn01_00094525 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025250 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192385 predicted 1219
2 SASI_Mm01_00192386 predicted 1539
3 SASI_Mm01_00192387 predicted 1749
4 SASI_Mm01_00192388 predicted 1494
5 SASI_Mm01_00192389 predicted 1478
6 SASI_Mm01_00192390 predicted 1545
7 SASI_Mm01_00192391 predicted 1633
8 SASI_Mm01_00192392 predicted 1311
9 SASI_Mm01_00192393 predicted 1761
10 SASI_Mm01_00192394 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043174 predicted 1218
2 SASI_Mm01_00043176 predicted 1546
3 SASI_Mm01_00043177 predicted 1308
4 SASI_Mm01_00043178 predicted 1563
5 SASI_Mm01_00043179 predicted 1744
6 SASI_Mm01_00043180 predicted 1221
7 SASI_Mm01_00043181 predicted 1526
8 SASI_Mm01_00043182 predicted 1900
9 SASI_Mm01_00043183 predicted 1875
10 SASI_Mm02_00287808 predicted 1169
11 SASI_Mm01_00043175 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305206 predicted 844
2 SASI_Mm02_00305207 predicted 1060
3 SASI_Mm02_00305208 predicted 795
4 SASI_Mm02_00305209 predicted 789
5 SASI_Mm02_00305210 predicted 861
6 SASI_Mm02_00305211 predicted 938
7 SASI_Mm02_00305212 predicted 634
8 SASI_Mm02_00305213 predicted 1073
9 SASI_Mm02_00305214 predicted 1388
10 SASI_Mm02_00305215 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305216 predicted 776
2 SASI_Mm02_00305217 predicted 981
3 SASI_Mm02_00305218 predicted 787
4 SASI_Mm02_00305219 predicted 866
5 SASI_Mm02_00305220 predicted 626
6 SASI_Mm02_00305221 predicted 1004
7 SASI_Mm02_00305222 predicted 1311
8 SASI_Mm02_00305223 predicted 1191
9 SASI_Mm02_00305224 predicted 972
10 SASI_Mm02_00305225 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110268 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305226 predicted 814
2 SASI_Mm02_00305227 predicted 850
3 SASI_Mm02_00305228 predicted 818
4 SASI_Mm02_00305229 predicted 890
5 SASI_Mm02_00305230 predicted 633
6 SASI_Mm02_00305231 predicted 698
7 SASI_Mm02_00305232 predicted 871
8 SASI_Mm02_00305233 predicted 1052
9 SASI_Mm02_00305234 predicted 1250
10 SASI_Mm02_00305235 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127527 predicted 1216
2 SASI_Mm01_00127528 predicted 1462
3 SASI_Mm01_00127529 predicted 1674
4 SASI_Mm01_00127530 predicted 1481
5 SASI_Mm01_00127531 predicted 1560
6 SASI_Mm01_00127532 predicted 1313
7 SASI_Mm01_00127533 predicted 1694
8 SASI_Mm02_00316282 predicted 1882
9 SASI_Mm01_00127534 predicted 1216
10 SASI_Mm01_00127535 predicted 1655
11 SASI_Mm01_00127536 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009505
VALIDATED
VEGFA MISSION shRNA Bacterial Glycerol Stock
vascular endothelial growth factor A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1138s21c1
Sequence:CCGGGATCAAGTTCATGGATGTCTACTCGAGTAGACATCCATGAACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1219s21c1
Sequence:CCGGCGAGATAGAGTACATCTTCAACTCGAGTTGAAGATGTACTCTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1460s21c1
Sequence:CCGGGAGCGGAGAAAGCATTTGTTTCTCGAGAAACAAATGCTTTCTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1644s21c1
Sequence:CCGGTCACCGGAAAGACCGATTAACCTCGAGGTTAATCGGTCTTTCCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1484s21c1
Sequence:CCGGCAAGATCCGCAGACGTGTAAACTCGAGTTTACACGTCTGCGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009505.2-592s1c1
Sequence:CCGGCGAGATAGAGTACATCTTCAACTCGAGTTGAAGATGTACTCTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009505.2-511s1c1
Sequence:CCGGGATCAAGTTCATGGATGTCTACTCGAGTAGACATCCATGAACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009505.2-711s1c1
Sequence:CCGGTGCGGATCAAACCTCACCAAACTCGAGTTTGGTGAGGTTTGATCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009505.2-833s1c1
Sequence:CCGGGAGCGGAGAAAGCATTTGTTTCTCGAGAAACAAATGCTTTCTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009505.2-780s1c1
Sequence:CCGGGCAGACCAAAGAAAGACAGAACTCGAGTTCTGTCTTTCTTTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009505
VALIDATED
VEGFA MISSION shRNA shRNA Plasmid DNA
vascular endothelial growth factor A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1138s21c1
Sequence:CCGGGATCAAGTTCATGGATGTCTACTCGAGTAGACATCCATGAACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1219s21c1
Sequence:CCGGCGAGATAGAGTACATCTTCAACTCGAGTTGAAGATGTACTCTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1460s21c1
Sequence:CCGGGAGCGGAGAAAGCATTTGTTTCTCGAGAAACAAATGCTTTCTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1644s21c1
Sequence:CCGGTCACCGGAAAGACCGATTAACCTCGAGGTTAATCGGTCTTTCCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1484s21c1
Sequence:CCGGCAAGATCCGCAGACGTGTAAACTCGAGTTTACACGTCTGCGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009505.2-592s1c1
Sequence:CCGGCGAGATAGAGTACATCTTCAACTCGAGTTGAAGATGTACTCTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009505.2-511s1c1
Sequence:CCGGGATCAAGTTCATGGATGTCTACTCGAGTAGACATCCATGAACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009505.2-711s1c1
Sequence:CCGGTGCGGATCAAACCTCACCAAACTCGAGTTTGGTGAGGTTTGATCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009505.2-833s1c1
Sequence:CCGGGAGCGGAGAAAGCATTTGTTTCTCGAGAAACAAATGCTTTCTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009505.2-780s1c1
Sequence:CCGGGCAGACCAAAGAAAGACAGAACTCGAGTTCTGTCTTTCTTTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009505
VALIDATED
VEGFA MISSION shRNA Lentiviral Transduction Particles
vascular endothelial growth factor A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1138s21c1
Sequence:CCGGGATCAAGTTCATGGATGTCTACTCGAGTAGACATCCATGAACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1219s21c1
Sequence:CCGGCGAGATAGAGTACATCTTCAACTCGAGTTGAAGATGTACTCTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1460s21c1
Sequence:CCGGGAGCGGAGAAAGCATTTGTTTCTCGAGAAACAAATGCTTTCTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1644s21c1
Sequence:CCGGTCACCGGAAAGACCGATTAACCTCGAGGTTAATCGGTCTTTCCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009505.4-1484s21c1
Sequence:CCGGCAAGATCCGCAGACGTGTAAACTCGAGTTTACACGTCTGCGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009505.2-592s1c1
Sequence:CCGGCGAGATAGAGTACATCTTCAACTCGAGTTGAAGATGTACTCTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009505.2-511s1c1
Sequence:CCGGGATCAAGTTCATGGATGTCTACTCGAGTAGACATCCATGAACTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009505.2-711s1c1
Sequence:CCGGTGCGGATCAAACCTCACCAAACTCGAGTTTGGTGAGGTTTGATCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009505.2-833s1c1
Sequence:CCGGGAGCGGAGAAAGCATTTGTTTCTCGAGAAACAAATGCTTTCTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009505.2-780s1c1
Sequence:CCGGGCAGACCAAAGAAAGACAGAACTCGAGTTCTGTCTTTCTTTGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003376
VALIDATED
VEGFA MISSION shRNA Bacterial Glycerol Stock
vascular endothelial growth factor A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1569s21c1
Sequence:CCGGCAAGATCCGCAGACGTGTAAACTCGAGTTTACACGTCTGCGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003376.4-1796s21c1
Sequence:CCGGTCGACAGAACAGTCCTTAATCCTCGAGGATTAAGGACTGTTCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1621s21c1
Sequence:CCGGAGGCGAGGCAGCTTGAGTTAACTCGAGTTAACTCAAGCTGCCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1342s21c1
Sequence:CCGGTGCAGATTATGCGGATCAAACCTCGAGGTTTGATCCGCATAATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1492s21c1
Sequence:CCGGAGCGCAAGAAATCCCGGTATACTCGAGTATACCGGGATTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003376.x-1137s1c1
Sequence:CCGGAGGGCAGAATCATCACGAAGTCTCGAGACTTCGTGATGATTCTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003376.x-1587s1c1
Sequence:CCGGGACGTGTAAATGTTCCTGCAACTCGAGTTGCAGGAACATTTACACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003376.x-1357s1c1
Sequence:CCGGATGCGGATCAAACCTCACCAACTCGAGTTGGTGAGGTTTGATCCGCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003376.x-1650s1c1
Sequence:CCGGCGAACGTACTTGCAGATGTGACTCGAGTCACATCTGCAAGTACGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003376.x-1500s1c1
Sequence:CCGGGCGCAAGAAATCCCGGTATAACTCGAGTTATACCGGGATTTCTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003376
VALIDATED
VEGFA MISSION shRNA shRNA Plasmid DNA
vascular endothelial growth factor A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1569s21c1
Sequence:CCGGCAAGATCCGCAGACGTGTAAACTCGAGTTTACACGTCTGCGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003376.4-1796s21c1
Sequence:CCGGTCGACAGAACAGTCCTTAATCCTCGAGGATTAAGGACTGTTCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1621s21c1
Sequence:CCGGAGGCGAGGCAGCTTGAGTTAACTCGAGTTAACTCAAGCTGCCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1342s21c1
Sequence:CCGGTGCAGATTATGCGGATCAAACCTCGAGGTTTGATCCGCATAATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1492s21c1
Sequence:CCGGAGCGCAAGAAATCCCGGTATACTCGAGTATACCGGGATTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003376.x-1137s1c1
Sequence:CCGGAGGGCAGAATCATCACGAAGTCTCGAGACTTCGTGATGATTCTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003376.x-1587s1c1
Sequence:CCGGGACGTGTAAATGTTCCTGCAACTCGAGTTGCAGGAACATTTACACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003376.x-1357s1c1
Sequence:CCGGATGCGGATCAAACCTCACCAACTCGAGTTGGTGAGGTTTGATCCGCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003376.x-1650s1c1
Sequence:CCGGCGAACGTACTTGCAGATGTGACTCGAGTCACATCTGCAAGTACGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003376.x-1500s1c1
Sequence:CCGGGCGCAAGAAATCCCGGTATAACTCGAGTTATACCGGGATTTCTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003376
VALIDATED
VEGFA MISSION shRNA Lentiviral Transduction Particles
vascular endothelial growth factor A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1569s21c1
Sequence:CCGGCAAGATCCGCAGACGTGTAAACTCGAGTTTACACGTCTGCGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003376.4-1796s21c1
Sequence:CCGGTCGACAGAACAGTCCTTAATCCTCGAGGATTAAGGACTGTTCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1621s21c1
Sequence:CCGGAGGCGAGGCAGCTTGAGTTAACTCGAGTTAACTCAAGCTGCCTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1342s21c1
Sequence:CCGGTGCAGATTATGCGGATCAAACCTCGAGGTTTGATCCGCATAATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003376.4-1492s21c1
Sequence:CCGGAGCGCAAGAAATCCCGGTATACTCGAGTATACCGGGATTTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003376.x-1137s1c1
Sequence:CCGGAGGGCAGAATCATCACGAAGTCTCGAGACTTCGTGATGATTCTGCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003376.x-1587s1c1
Sequence:CCGGGACGTGTAAATGTTCCTGCAACTCGAGTTGCAGGAACATTTACACGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003376.x-1357s1c1
Sequence:CCGGATGCGGATCAAACCTCACCAACTCGAGTTGGTGAGGTTTGATCCGCATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003376.x-1650s1c1
Sequence:CCGGCGAACGTACTTGCAGATGTGACTCGAGTCACATCTGCAAGTACGTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003376.x-1500s1c1
Sequence:CCGGGCGCAAGAAATCCCGGTATAACTCGAGTTATACCGGGATTTCTTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks