EMAIL THIS PAGE TO A FRIEND

VEGFB

vascular endothelial growth factor B

Synonyms: VEGFL VRF
UniProtKB ID: P49765, Q16528
Gene ID:
Human(7423) Summary: This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]
Mouse(22340) vascular endothelial growth factor B
Rat(89811) vascular endothelial growth factor B
domestic cat(101092465) vascular endothelial growth factor B
dog(476036) vascular endothelial growth factor B
naked mole-rat(101700074) vascular endothelial growth factor B
domestic guinea pig(100724743) vascular endothelial growth factor B
cow(282121) vascular endothelial growth factor B
sheep(101115840) vascular endothelial growth factor B
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T0318 Tranilast ≥98% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003377 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003377 Rosetta Predictions human pricing
NM_053549 Rosetta Predictions rat pricing
NM_011697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195503 predicted 876
2 SASI_Hs01_00195504 predicted 626
3 SASI_Hs01_00195505 predicted 730
4 SASI_Hs01_00195506 predicted 769
5 SASI_Hs01_00195507 predicted 721
6 SASI_Hs01_00195508 predicted 830
7 SASI_Hs01_00195509 predicted 879
8 SASI_Hs01_00195510 predicted 683
9 SASI_Hs01_00195511 predicted 876
10 SASI_Hs01_00195512 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266192 predicted 359
2 SASI_Rn02_00266193 predicted 896
3 SASI_Rn02_00266194 predicted 542
4 SASI_Rn02_00266195 predicted 1096
5 SASI_Rn02_00266196 predicted 971
6 SASI_Rn02_00266197 predicted 435
7 SASI_Rn02_00266198 predicted 554
8 SASI_Rn02_00266199 predicted 808
9 SASI_Rn02_00266200 predicted 349
10 SASI_Rn02_00266201 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114251 predicted 778
2 SASI_Mm01_00114252 predicted 856
3 SASI_Mm01_00114253 predicted 288
4 SASI_Mm01_00114254 predicted 342
5 SASI_Mm01_00114256 predicted 282
6 SASI_Mm01_00114257 predicted 295
7 SASI_Mm01_00114258 predicted 847
8 SASI_Mm01_00114259 predicted 292
9 SASI_Mm01_00114260 predicted 876
10 SASI_Mm02_00321256 predicted 307
11 SASI_Mm01_00114255 predicted 816
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011697
VALIDATED
VEGFB MISSION shRNA Bacterial Glycerol Stock
vascular endothelial growth factor B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-551s1c1
Sequence:CCGGGCCAATGTGAATGCAGACCAACTCGAGTTGGTCTGCATTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-437s1c1
Sequence:CCGGGCCCTGACGATGGCCTGGAATCTCGAGATTCCAGGCCATCGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-489s1c1
Sequence:CCGGGCAGATCCTCATGATCCAGTACTCGAGTACTGGATCATGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-301s1c1
Sequence:CCGGCCATGGATAGACGTTTATGCACTCGAGTGCATAAACGTCTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-361s1c1
Sequence:CCGGAGCATGGAACTCATGGGCAATCTCGAGATTGCCCATGAGTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-551s21c1
Sequence:CCGGGCCAATGTGAATGCAGACCAACTCGAGTTGGTCTGCATTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-437s21c1
Sequence:CCGGGCCCTGACGATGGCCTGGAATCTCGAGATTCCAGGCCATCGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-489s21c1
Sequence:CCGGGCAGATCCTCATGATCCAGTACTCGAGTACTGGATCATGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-301s21c1
Sequence:CCGGCCATGGATAGACGTTTATGCACTCGAGTGCATAAACGTCTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011697
VALIDATED
VEGFB MISSION shRNA shRNA Plasmid DNA
vascular endothelial growth factor B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-551s1c1
Sequence:CCGGGCCAATGTGAATGCAGACCAACTCGAGTTGGTCTGCATTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-437s1c1
Sequence:CCGGGCCCTGACGATGGCCTGGAATCTCGAGATTCCAGGCCATCGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-489s1c1
Sequence:CCGGGCAGATCCTCATGATCCAGTACTCGAGTACTGGATCATGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-301s1c1
Sequence:CCGGCCATGGATAGACGTTTATGCACTCGAGTGCATAAACGTCTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-361s1c1
Sequence:CCGGAGCATGGAACTCATGGGCAATCTCGAGATTGCCCATGAGTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-551s21c1
Sequence:CCGGGCCAATGTGAATGCAGACCAACTCGAGTTGGTCTGCATTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-437s21c1
Sequence:CCGGGCCCTGACGATGGCCTGGAATCTCGAGATTCCAGGCCATCGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-489s21c1
Sequence:CCGGGCAGATCCTCATGATCCAGTACTCGAGTACTGGATCATGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-301s21c1
Sequence:CCGGCCATGGATAGACGTTTATGCACTCGAGTGCATAAACGTCTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011697
VALIDATED
VEGFB MISSION shRNA Lentiviral Transduction Particles
vascular endothelial growth factor B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-551s1c1
Sequence:CCGGGCCAATGTGAATGCAGACCAACTCGAGTTGGTCTGCATTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-437s1c1
Sequence:CCGGGCCCTGACGATGGCCTGGAATCTCGAGATTCCAGGCCATCGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-489s1c1
Sequence:CCGGGCAGATCCTCATGATCCAGTACTCGAGTACTGGATCATGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-301s1c1
Sequence:CCGGCCATGGATAGACGTTTATGCACTCGAGTGCATAAACGTCTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011697.1-361s1c1
Sequence:CCGGAGCATGGAACTCATGGGCAATCTCGAGATTGCCCATGAGTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-551s21c1
Sequence:CCGGGCCAATGTGAATGCAGACCAACTCGAGTTGGTCTGCATTCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-437s21c1
Sequence:CCGGGCCCTGACGATGGCCTGGAATCTCGAGATTCCAGGCCATCGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-489s21c1
Sequence:CCGGGCAGATCCTCATGATCCAGTACTCGAGTACTGGATCATGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011697.2-301s21c1
Sequence:CCGGCCATGGATAGACGTTTATGCACTCGAGTGCATAAACGTCTATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003377
VEGFB MISSION shRNA Bacterial Glycerol Stock
vascular endothelial growth factor B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-527s1c1
Sequence:CCGGGCTGACATCACCCATCCCACTCTCGAGAGTGGGATGGGTGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-400s1c1
Sequence:CCGGCCAGTGTGAATGCAGACCTAACTCGAGTTAGGTCTGCATTCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-132s1c1
Sequence:CCGGACCAGAGGAAAGTGGTGTCATCTCGAGATGACACCACTTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-337s1c1
Sequence:CCGGGCAGATCCTCATGATCCGGTACTCGAGTACCGGATCATGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-146s1c1
Sequence:CCGGGTGTCATGGATAGATGTGTATCTCGAGATACACATCTATCCATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003377.3-660s21c1
Sequence:CCGGCTTAGAGCTCAACCCAGACACCTCGAGGTGTCTGGGTTGAGCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003377.3-737s21c1
Sequence:CCGGACTTGCCTCAGAGGCTATATCCTCGAGGATATAGCCTCTGAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003377.3-982s21c1
Sequence:CCGGTAACCACTCTGTGCAAGTAAGCTCGAGCTTACTTGCACAGAGTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003377
VEGFB MISSION shRNA shRNA Plasmid DNA
vascular endothelial growth factor B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-527s1c1
Sequence:CCGGGCTGACATCACCCATCCCACTCTCGAGAGTGGGATGGGTGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-400s1c1
Sequence:CCGGCCAGTGTGAATGCAGACCTAACTCGAGTTAGGTCTGCATTCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-132s1c1
Sequence:CCGGACCAGAGGAAAGTGGTGTCATCTCGAGATGACACCACTTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-337s1c1
Sequence:CCGGGCAGATCCTCATGATCCGGTACTCGAGTACCGGATCATGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-146s1c1
Sequence:CCGGGTGTCATGGATAGATGTGTATCTCGAGATACACATCTATCCATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003377.3-660s21c1
Sequence:CCGGCTTAGAGCTCAACCCAGACACCTCGAGGTGTCTGGGTTGAGCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003377.3-737s21c1
Sequence:CCGGACTTGCCTCAGAGGCTATATCCTCGAGGATATAGCCTCTGAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003377.3-982s21c1
Sequence:CCGGTAACCACTCTGTGCAAGTAAGCTCGAGCTTACTTGCACAGAGTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003377
VEGFB MISSION shRNA Lentiviral Transduction Particles
vascular endothelial growth factor B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-527s1c1
Sequence:CCGGGCTGACATCACCCATCCCACTCTCGAGAGTGGGATGGGTGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-400s1c1
Sequence:CCGGCCAGTGTGAATGCAGACCTAACTCGAGTTAGGTCTGCATTCACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-132s1c1
Sequence:CCGGACCAGAGGAAAGTGGTGTCATCTCGAGATGACACCACTTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-337s1c1
Sequence:CCGGGCAGATCCTCATGATCCGGTACTCGAGTACCGGATCATGAGGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003377.3-146s1c1
Sequence:CCGGGTGTCATGGATAGATGTGTATCTCGAGATACACATCTATCCATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003377.3-660s21c1
Sequence:CCGGCTTAGAGCTCAACCCAGACACCTCGAGGTGTCTGGGTTGAGCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003377.3-737s21c1
Sequence:CCGGACTTGCCTCAGAGGCTATATCCTCGAGGATATAGCCTCTGAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003377.3-982s21c1
Sequence:CCGGTAACCACTCTGTGCAAGTAAGCTCGAGCTTACTTGCACAGAGTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks