EMAIL THIS PAGE TO A FRIEND

VEGFC

vascular endothelial growth factor C

Synonyms: Flt4-L VRP
UniProtKB ID: P49767, B2R9Q8
Gene ID:
Human(7424) Summary: The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family, is active in angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. This secreted protein undergoes a complex proteolytic maturation, generating multiple processed forms which bind and activate VEGFR-3 receptors. Only the fully processed form can bind and activate VEGFR-2 receptors. This protein is structurally and functionally similar to vascular endothelial growth factor D. [provided by RefSeq, Jul 2008]
Mouse(22341) vascular endothelial growth factor C
Rat(114111) vascular endothelial growth factor C
Zebrafish(403049) vascular endothelial growth factor c
chicken(422573) vascular endothelial growth factor C
domestic cat(101085368) vascular endothelial growth factor C
dog(482932) vascular endothelial growth factor C
cow(282122) vascular endothelial growth factor C
sheep(101105629) vascular endothelial growth factor C
domestic guinea pig(100724469) vascular endothelial growth factor C
naked mole-rat(101719504) vascular endothelial growth factor C
Domestic Rabbit(100338211) vascular endothelial growth factor C
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T0318 Tranilast ≥98% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005429 siRNAs that have been validated in the lab human pricing
NM_053653 Rosetta Predictions rat pricing
NM_009506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005429 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167431 validated 1352
1 SASI_Hs01_00167429 validated 1159
1 SASI_Hs01_00167428 validated 1557
2 SASI_Hs02_00339578 predicted 1682
3 SASI_Hs01_00167432 predicted 1253
4 SASI_Hs01_00167433 predicted 1521
5 SASI_Hs02_00339579 predicted 763
6 SASI_Hs01_00167435 predicted 1355
7 SASI_Hs01_00167436 predicted 848
8 SASI_Hs01_00167437 predicted 1542
9 SASI_Hs01_00167430 predicted 1165
10 SASI_Hs01_00167434 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068416 predicted 1322
2 SASI_Rn01_00068417 predicted 1187
3 SASI_Rn01_00068418 predicted 1203
4 SASI_Rn02_00266376 predicted 492
5 SASI_Rn01_00068419 predicted 1063
6 SASI_Rn01_00068420 predicted 915
7 SASI_Rn01_00068421 predicted 1218
8 SASI_Rn02_00266377 predicted 519
9 SASI_Rn01_00068422 predicted 1000
10 SASI_Rn01_00068423 predicted 689
11 SASI_Rn01_00068424 predicted 608
12 SASI_Rn01_00068425 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167316 predicted 947
2 SASI_Mm02_00316283 predicted 1485
3 SASI_Mm01_00167317 predicted 658
4 SASI_Mm01_00167319 predicted 762
5 SASI_Mm01_00167320 predicted 1407
6 SASI_Mm01_00167321 predicted 1200
7 SASI_Mm02_00316284 predicted 1478
8 SASI_Mm01_00167322 predicted 1159
9 SASI_Mm01_00167324 predicted 1386
10 SASI_Mm02_00316285 predicted 1346
11 SASI_Mm01_00167318 predicted 1206
12 SASI_Mm01_00167323 predicted 966
13 SASI_Mm01_00167325 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005429
VEGFC MISSION shRNA Bacterial Glycerol Stock
vascular endothelial growth factor C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005429.2-1894s21c1
Sequence:CCGGATGACCAAACAGCCAAGATTTCTCGAGAAATCTTGGCTGTTTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005429.2-1647s21c1
Sequence:CCGGGTCGTTGTGTCCCTTCATATTCTCGAGAATATGAAGGGACACAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005429.2-1163s21c1
Sequence:CCGGACCAATTACATGTGGAATAATCTCGAGATTATTCCACATGTAATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005429.2-967s21c1
Sequence:CCGGCTACCTCAGCAAGACGTTATTCTCGAGAATAACGTCTTGCTGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-868s1c1
Sequence:CCGGCGCGACAAACACCTTCTTTAACTCGAGTTAAAGAAGGTGTTTGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1347s1c1
Sequence:CCGGCCCACAAAGAACTAGACAGAACTCGAGTTCTGTCTAGTTCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1419s1c1
Sequence:CCGGCCAACCGAGAATTTGATGAAACTCGAGTTTCATCAAATTCTCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1018s1c1
Sequence:CCGGCAAACCAGTAACAATCAGTTTCTCGAGAAACTGATTGTTACTGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1561s1c1
Sequence:CCGGCCACCAAACATGCAGCTGTTACTCGAGTAACAGCTGCATGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005429
VEGFC MISSION shRNA shRNA Plasmid DNA
vascular endothelial growth factor C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005429.2-1894s21c1
Sequence:CCGGATGACCAAACAGCCAAGATTTCTCGAGAAATCTTGGCTGTTTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005429.2-1647s21c1
Sequence:CCGGGTCGTTGTGTCCCTTCATATTCTCGAGAATATGAAGGGACACAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005429.2-1163s21c1
Sequence:CCGGACCAATTACATGTGGAATAATCTCGAGATTATTCCACATGTAATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005429.2-967s21c1
Sequence:CCGGCTACCTCAGCAAGACGTTATTCTCGAGAATAACGTCTTGCTGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-868s1c1
Sequence:CCGGCGCGACAAACACCTTCTTTAACTCGAGTTAAAGAAGGTGTTTGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1347s1c1
Sequence:CCGGCCCACAAAGAACTAGACAGAACTCGAGTTCTGTCTAGTTCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1419s1c1
Sequence:CCGGCCAACCGAGAATTTGATGAAACTCGAGTTTCATCAAATTCTCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1018s1c1
Sequence:CCGGCAAACCAGTAACAATCAGTTTCTCGAGAAACTGATTGTTACTGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1561s1c1
Sequence:CCGGCCACCAAACATGCAGCTGTTACTCGAGTAACAGCTGCATGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005429
VEGFC MISSION shRNA Lentiviral Transduction Particles
vascular endothelial growth factor C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005429.2-1894s21c1
Sequence:CCGGATGACCAAACAGCCAAGATTTCTCGAGAAATCTTGGCTGTTTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005429.2-1647s21c1
Sequence:CCGGGTCGTTGTGTCCCTTCATATTCTCGAGAATATGAAGGGACACAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005429.2-1163s21c1
Sequence:CCGGACCAATTACATGTGGAATAATCTCGAGATTATTCCACATGTAATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005429.2-967s21c1
Sequence:CCGGCTACCTCAGCAAGACGTTATTCTCGAGAATAACGTCTTGCTGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-868s1c1
Sequence:CCGGCGCGACAAACACCTTCTTTAACTCGAGTTAAAGAAGGTGTTTGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1347s1c1
Sequence:CCGGCCCACAAAGAACTAGACAGAACTCGAGTTCTGTCTAGTTCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1419s1c1
Sequence:CCGGCCAACCGAGAATTTGATGAAACTCGAGTTTCATCAAATTCTCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1018s1c1
Sequence:CCGGCAAACCAGTAACAATCAGTTTCTCGAGAAACTGATTGTTACTGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005429.2-1561s1c1
Sequence:CCGGCCACCAAACATGCAGCTGTTACTCGAGTAACAGCTGCATGTTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009506
VALIDATED
VEGFC MISSION shRNA Bacterial Glycerol Stock
vascular endothelial growth factor C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-1532s21c1
Sequence:CCGGTGAAGAACTGTTGCCACATTACTCGAGTAATGTGGCAACAGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009506.2-559s21c1
Sequence:CCGGATTTGCTGCTGCACATTATAACTCGAGTTATAATGTGCAGCAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-889s21c1
Sequence:CCGGCAGACAAGTTCATTCAATTATCTCGAGATAATTGAATGAACTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-774s21c1
Sequence:CCGGACCTCAGCAAGACGTTGTTTGCTCGAGCAAACAACGTCTTGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-1483s21c1
Sequence:CCGGACATCTGAACTAAGATCATACCTCGAGGTATGATCTTAGTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009506.1-1516s1c1
Sequence:CCGGCCCAAGTCTGTGTTTATTGAACTCGAGTTCAATAAACACAGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009506.1-1113s1c1
Sequence:CCGGCCCTAATTCATGTGGAGCCAACTCGAGTTGGCTCCACATGAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009506.1-577s1c1
Sequence:CCGGGCAGCCACAAACACCTTCTTTCTCGAGAAAGAAGGTGTTTGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009506.1-1272s1c1
Sequence:CCGGCCATCAAACATGCAGTTGTTACTCGAGTAACAACTGCATGTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009506.1-871s1c1
Sequence:CCGGCCAACAAACTATGTGTGGAATCTCGAGATTCCACACATAGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009506
VALIDATED
VEGFC MISSION shRNA shRNA Plasmid DNA
vascular endothelial growth factor C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-1532s21c1
Sequence:CCGGTGAAGAACTGTTGCCACATTACTCGAGTAATGTGGCAACAGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009506.2-559s21c1
Sequence:CCGGATTTGCTGCTGCACATTATAACTCGAGTTATAATGTGCAGCAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-889s21c1
Sequence:CCGGCAGACAAGTTCATTCAATTATCTCGAGATAATTGAATGAACTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-774s21c1
Sequence:CCGGACCTCAGCAAGACGTTGTTTGCTCGAGCAAACAACGTCTTGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-1483s21c1
Sequence:CCGGACATCTGAACTAAGATCATACCTCGAGGTATGATCTTAGTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009506.1-1516s1c1
Sequence:CCGGCCCAAGTCTGTGTTTATTGAACTCGAGTTCAATAAACACAGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009506.1-1113s1c1
Sequence:CCGGCCCTAATTCATGTGGAGCCAACTCGAGTTGGCTCCACATGAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009506.1-577s1c1
Sequence:CCGGGCAGCCACAAACACCTTCTTTCTCGAGAAAGAAGGTGTTTGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009506.1-1272s1c1
Sequence:CCGGCCATCAAACATGCAGTTGTTACTCGAGTAACAACTGCATGTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009506.1-871s1c1
Sequence:CCGGCCAACAAACTATGTGTGGAATCTCGAGATTCCACACATAGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009506
VALIDATED
VEGFC MISSION shRNA Lentiviral Transduction Particles
vascular endothelial growth factor C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-1532s21c1
Sequence:CCGGTGAAGAACTGTTGCCACATTACTCGAGTAATGTGGCAACAGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009506.2-559s21c1
Sequence:CCGGATTTGCTGCTGCACATTATAACTCGAGTTATAATGTGCAGCAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-889s21c1
Sequence:CCGGCAGACAAGTTCATTCAATTATCTCGAGATAATTGAATGAACTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-774s21c1
Sequence:CCGGACCTCAGCAAGACGTTGTTTGCTCGAGCAAACAACGTCTTGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009506.2-1483s21c1
Sequence:CCGGACATCTGAACTAAGATCATACCTCGAGGTATGATCTTAGTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009506.1-1516s1c1
Sequence:CCGGCCCAAGTCTGTGTTTATTGAACTCGAGTTCAATAAACACAGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009506.1-1113s1c1
Sequence:CCGGCCCTAATTCATGTGGAGCCAACTCGAGTTGGCTCCACATGAATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009506.1-577s1c1
Sequence:CCGGGCAGCCACAAACACCTTCTTTCTCGAGAAAGAAGGTGTTTGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009506.1-1272s1c1
Sequence:CCGGCCATCAAACATGCAGTTGTTACTCGAGTAACAACTGCATGTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009506.1-871s1c1
Sequence:CCGGCCAACAAACTATGTGTGGAATCTCGAGATTCCACACATAGTTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks