EMAIL THIS PAGE TO A FRIEND

VENTX

VENT homeobox

Synonyms: HPX42B NA88A VENTX2
UniProtKB ID: O95231, Q32MZ3
Gene ID:
Human(27287) Summary: This gene encodes a member of the Vent family of homeodomain proteins. The encoded protein may function as a transcriptional repressor and be involved in mesodermal patterning and hemopoietic stem cell maintenance. Multiple pseudogenes exist for this gene. A transcribed pseudogene located on chromosome X may lead to antigen production in certain melanomas. [provided by RefSeq, Jul 2008]
chicken(430089) VENT homeobox
chicken(101750857) VENT homeobox
domestic cat(101088619) VENT homeobox
dog(100688982) VENT homeobox
dog(491700) VENT homeobox
chicken(101665693) VENT homeobox
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014468 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049341 MISSION® esiRNA esiRNA human VENTX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014468 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168596 predicted 518
2 SASI_Hs01_00168597 predicted 525
3 SASI_Hs02_00345690 predicted 363
4 SASI_Hs01_00168595 predicted 505
5 SASI_Hs02_00345691 predicted 854
6 SASI_Hs02_00345692 predicted 828
7 SASI_Hs02_00345693 predicted 517
8 SASI_Hs02_00345694 predicted 620
9 SASI_Hs02_00345695 predicted 295
10 SASI_Hs02_00345696 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014468
VENTX MISSION shRNA Bacterial Glycerol Stock
VENT homeobox
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-440s1c1
Sequence:CCGGCATGAAACACAAACGGCAAATCTCGAGATTTGCCGTTTGTGTTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-42s1c1
Sequence:CCGGCCGCAGCAGCTCTCCAGCTTTCTCGAGAAAGCTGGAGAGCTGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-320s1c1
Sequence:CCGGCCGCACCTTGGAGGGCGTCTTCTCGAGAAGACGCCCTCCAAGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-251s1c1
Sequence:CCGGCGGGTTGAGTAAGGAGCCAAACTCGAGTTTGGCTCCTTACTCAACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014468.2-784s21c1
Sequence:CCGGTTTGAGGAGGCACCTCTGACTCTCGAGAGTCAGAGGTGCCTCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014468.2-425s21c1
Sequence:CCGGGTTTCAGAATCGCCGCATGAACTCGAGTTCATGCGGCGATTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014468.2-260s21c1
Sequence:CCGGTAAGGAGCCAAATACCTTGCGCTCGAGCGCAAGGTATTTGGCTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014468
VENTX MISSION shRNA shRNA Plasmid DNA
VENT homeobox
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-440s1c1
Sequence:CCGGCATGAAACACAAACGGCAAATCTCGAGATTTGCCGTTTGTGTTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-42s1c1
Sequence:CCGGCCGCAGCAGCTCTCCAGCTTTCTCGAGAAAGCTGGAGAGCTGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-320s1c1
Sequence:CCGGCCGCACCTTGGAGGGCGTCTTCTCGAGAAGACGCCCTCCAAGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-251s1c1
Sequence:CCGGCGGGTTGAGTAAGGAGCCAAACTCGAGTTTGGCTCCTTACTCAACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014468.2-784s21c1
Sequence:CCGGTTTGAGGAGGCACCTCTGACTCTCGAGAGTCAGAGGTGCCTCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014468.2-425s21c1
Sequence:CCGGGTTTCAGAATCGCCGCATGAACTCGAGTTCATGCGGCGATTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014468.2-260s21c1
Sequence:CCGGTAAGGAGCCAAATACCTTGCGCTCGAGCGCAAGGTATTTGGCTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014468
VENTX MISSION shRNA Lentiviral Transduction Particles
VENT homeobox
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-440s1c1
Sequence:CCGGCATGAAACACAAACGGCAAATCTCGAGATTTGCCGTTTGTGTTTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-42s1c1
Sequence:CCGGCCGCAGCAGCTCTCCAGCTTTCTCGAGAAAGCTGGAGAGCTGCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-320s1c1
Sequence:CCGGCCGCACCTTGGAGGGCGTCTTCTCGAGAAGACGCCCTCCAAGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014468.2-251s1c1
Sequence:CCGGCGGGTTGAGTAAGGAGCCAAACTCGAGTTTGGCTCCTTACTCAACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014468.2-784s21c1
Sequence:CCGGTTTGAGGAGGCACCTCTGACTCTCGAGAGTCAGAGGTGCCTCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014468.2-425s21c1
Sequence:CCGGGTTTCAGAATCGCCGCATGAACTCGAGTTCATGCGGCGATTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014468.2-260s21c1
Sequence:CCGGTAAGGAGCCAAATACCTTGCGCTCGAGCGCAAGGTATTTGGCTCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks