EMAIL THIS PAGE TO A FRIEND

VEPH1

ventricular zone expressed PH domain-containing 1

Synonyms: MELT VEPH
Gene ID:
Mouse(72789) ventricular zone expressed PH domain-containing 1
Rat(361954) ventricular zone expressed PH domain-containing 1
chicken(100859365) ventricular zone expressed PH domain homolog 1 (zebrafish)
domestic cat(101085147) ventricular zone expressed PH domain homolog 1 (zebrafish)
Horse(100056414) ventricular zone expressed PH domain homolog 1 (zebrafish)
dog(485731) ventricular zone expressed PH domain homolog 1 (zebrafish)
domestic guinea pig(100728081) ventricular zone expressed PH domain-containing 1
Domestic Rabbit(100343227) ventricular zone expressed PH domain homolog 1 (zebrafish)
naked mole-rat(101724343) ventricular zone expressed PH domain-containing 1
cow(100337421) ventricular zone expressed PH domain homolog 1 (zebrafish)
sheep(101109058) ventricular zone expressed PH domain homolog 1 (zebrafish)
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA026645 Anti-VEPH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024621 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024621 Rosetta Predictions human pricing
NM_001014171 Rosetta Predictions rat pricing
NM_028357 Rosetta Predictions mouse pricing
NM_145820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069533 predicted 1680
2 SASI_Hs01_00069534 predicted 2794
3 SASI_Hs01_00069535 predicted 1639
4 SASI_Hs01_00069536 predicted 1483
5 SASI_Hs01_00069537 predicted 740
6 SASI_Hs02_00356997 predicted 2427
7 SASI_Hs01_00069538 predicted 861
8 SASI_Hs01_00069539 predicted 482
9 SASI_Hs02_00356998 predicted 750
10 SASI_Hs01_00069540 predicted 2731
11 SASI_Hs01_00069532 predicted 2225
12 SASI_Hs01_00069541 predicted 1067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078395 predicted 2730
2 SASI_Rn01_00078396 predicted 515
3 SASI_Rn01_00078399 predicted 954
4 SASI_Rn01_00078400 predicted 1840
5 SASI_Rn01_00078401 predicted 316
6 SASI_Rn01_00078402 predicted 1078
7 SASI_Rn01_00078403 predicted 1857
8 SASI_Rn01_00078404 predicted 1942
9 SASI_Rn02_00201666 predicted 1342
10 SASI_Rn02_00201667 predicted 2739
11 SASI_Rn01_00078397 predicted 1700
12 SASI_Rn01_00078398 predicted 2450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033227 predicted 919
2 SASI_Mm01_00033228 predicted 923
3 SASI_Mm01_00033229 predicted 618
4 SASI_Mm01_00033230 predicted 1008
5 SASI_Mm02_00333733 predicted 809
6 SASI_Mm01_00033231 predicted 957
7 SASI_Mm01_00033232 predicted 795
8 SASI_Mm01_00033233 predicted 751
9 SASI_Mm01_00033234 predicted 694
10 SASI_Mm01_00033235 predicted 796
11 SASI_Mm01_00033236 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341282 predicted 526
2 SASI_Mm01_00129622 predicted 1974
3 SASI_Mm01_00129623 predicted 2000
4 SASI_Mm01_00129624 predicted 1829
5 SASI_Mm01_00129625 predicted 1124
6 SASI_Mm01_00129627 predicted 1647
7 SASI_Mm01_00129628 predicted 659
8 SASI_Mm01_00129630 predicted 2083
9 SASI_Mm01_00129631 predicted 956
10 SASI_Mm02_00341283 predicted 2104
11 SASI_Mm01_00129626 predicted 1558
12 SASI_Mm01_00129629 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024621
VALIDATED
VEPH1 MISSION shRNA Bacterial Glycerol Stock
ventricular zone expressed PH domain-containing 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024621.2-1282s21c1
Sequence:CCGGGACAGATGGCAAGGATTTATGCTCGAGCATAAATCCTTGCCATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024621.2-3110s21c1
Sequence:CCGGGTATTGACTTCAGAATATATCCTCGAGGATATATTCTGAAGTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024621.1-2807s1c1
Sequence:CCGGCACATATCTGTAGGGATTTATCTCGAGATAAATCCCTACAGATATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024621.1-1276s1c1
Sequence:CCGGAGCATTCGTTTCACCATATTCCTCGAGGAATATGGTGAAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024621.2-3224s21c1
Sequence:CCGGACTTCTGTAGATATGTCATTTCTCGAGAAATGACATATCTACAGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024621.2-1939s21c1
Sequence:CCGGCAGTTTCATACCCAAATATTACTCGAGTAATATTTGGGTATGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024621.2-3082s21c1
Sequence:CCGGTAGTAAATGTCATACTCTAACCTCGAGGTTAGAGTATGACATTTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024621.2-578s21c1
Sequence:CCGGTGACCAGGCAGTAGTTGAAATCTCGAGATTTCAACTACTGCCTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-1492s1c1
Sequence:CCGGCCAAGCTCATAGTAACTGAAACTCGAGTTTCAGTTACTATGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-2604s1c1
Sequence:CCGGCCAATAGAACTCAGCAAAGTACTCGAGTACTTTGCTGAGTTCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024621.1-2113s1c1
Sequence:CCGGGCCTATACAGTAAGTCCAGTTCTCGAGAACTGGACTTACTGTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-1063s1c1
Sequence:CCGGCCCATAATGACATCATCCTAACTCGAGTTAGGATGATGTCATTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024621.1-2841s1c1
Sequence:CCGGCAATTATACACCACAGGCATTCTCGAGAATGCCTGTGGTGTATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-2114s1c1
Sequence:CCGGCCTATACAGTAAGTCCAGTTTCTCGAGAAACTGGACTTACTGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024621.1-842s1c1
Sequence:CCGGCCAAGGTAACACCATGTTGTTCTCGAGAACAACATGGTGTTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024621.1-2890s1c1
Sequence:CCGGGAGCTAAATTTACCAAGCCATCTCGAGATGGCTTGGTAAATTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024621
VALIDATED
VEPH1 MISSION shRNA shRNA Plasmid DNA
ventricular zone expressed PH domain-containing 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024621.2-1282s21c1
Sequence:CCGGGACAGATGGCAAGGATTTATGCTCGAGCATAAATCCTTGCCATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024621.2-3110s21c1
Sequence:CCGGGTATTGACTTCAGAATATATCCTCGAGGATATATTCTGAAGTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024621.1-2807s1c1
Sequence:CCGGCACATATCTGTAGGGATTTATCTCGAGATAAATCCCTACAGATATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024621.1-1276s1c1
Sequence:CCGGAGCATTCGTTTCACCATATTCCTCGAGGAATATGGTGAAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024621.2-3224s21c1
Sequence:CCGGACTTCTGTAGATATGTCATTTCTCGAGAAATGACATATCTACAGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024621.2-1939s21c1
Sequence:CCGGCAGTTTCATACCCAAATATTACTCGAGTAATATTTGGGTATGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024621.2-3082s21c1
Sequence:CCGGTAGTAAATGTCATACTCTAACCTCGAGGTTAGAGTATGACATTTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024621.2-578s21c1
Sequence:CCGGTGACCAGGCAGTAGTTGAAATCTCGAGATTTCAACTACTGCCTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-1492s1c1
Sequence:CCGGCCAAGCTCATAGTAACTGAAACTCGAGTTTCAGTTACTATGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-2604s1c1
Sequence:CCGGCCAATAGAACTCAGCAAAGTACTCGAGTACTTTGCTGAGTTCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024621.1-2113s1c1
Sequence:CCGGGCCTATACAGTAAGTCCAGTTCTCGAGAACTGGACTTACTGTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-1063s1c1
Sequence:CCGGCCCATAATGACATCATCCTAACTCGAGTTAGGATGATGTCATTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024621.1-2841s1c1
Sequence:CCGGCAATTATACACCACAGGCATTCTCGAGAATGCCTGTGGTGTATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-2114s1c1
Sequence:CCGGCCTATACAGTAAGTCCAGTTTCTCGAGAAACTGGACTTACTGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024621.1-842s1c1
Sequence:CCGGCCAAGGTAACACCATGTTGTTCTCGAGAACAACATGGTGTTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024621.1-2890s1c1
Sequence:CCGGGAGCTAAATTTACCAAGCCATCTCGAGATGGCTTGGTAAATTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024621
VALIDATED
VEPH1 MISSION shRNA Lentiviral Transduction Particles
ventricular zone expressed PH domain-containing 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024621.2-1282s21c1
Sequence:CCGGGACAGATGGCAAGGATTTATGCTCGAGCATAAATCCTTGCCATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024621.2-3110s21c1
Sequence:CCGGGTATTGACTTCAGAATATATCCTCGAGGATATATTCTGAAGTCAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024621.1-2807s1c1
Sequence:CCGGCACATATCTGTAGGGATTTATCTCGAGATAAATCCCTACAGATATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024621.1-1276s1c1
Sequence:CCGGAGCATTCGTTTCACCATATTCCTCGAGGAATATGGTGAAACGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024621.2-3224s21c1
Sequence:CCGGACTTCTGTAGATATGTCATTTCTCGAGAAATGACATATCTACAGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024621.2-1939s21c1
Sequence:CCGGCAGTTTCATACCCAAATATTACTCGAGTAATATTTGGGTATGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024621.2-3082s21c1
Sequence:CCGGTAGTAAATGTCATACTCTAACCTCGAGGTTAGAGTATGACATTTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024621.2-578s21c1
Sequence:CCGGTGACCAGGCAGTAGTTGAAATCTCGAGATTTCAACTACTGCCTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-1492s1c1
Sequence:CCGGCCAAGCTCATAGTAACTGAAACTCGAGTTTCAGTTACTATGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-2604s1c1
Sequence:CCGGCCAATAGAACTCAGCAAAGTACTCGAGTACTTTGCTGAGTTCTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_024621.1-2113s1c1
Sequence:CCGGGCCTATACAGTAAGTCCAGTTCTCGAGAACTGGACTTACTGTATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-1063s1c1
Sequence:CCGGCCCATAATGACATCATCCTAACTCGAGTTAGGATGATGTCATTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024621.1-2841s1c1
Sequence:CCGGCAATTATACACCACAGGCATTCTCGAGAATGCCTGTGGTGTATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_024621.1-2114s1c1
Sequence:CCGGCCTATACAGTAAGTCCAGTTTCTCGAGAAACTGGACTTACTGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024621.1-842s1c1
Sequence:CCGGCCAAGGTAACACCATGTTGTTCTCGAGAACAACATGGTGTTACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024621.1-2890s1c1
Sequence:CCGGGAGCTAAATTTACCAAGCCATCTCGAGATGGCTTGGTAAATTTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028357
VEPH1 MISSION shRNA Bacterial Glycerol Stock
ventricular zone expressed PH domain-containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028357.3-944s21c1
Sequence:CCGGGATTCGCACACCCGCTCTTATCTCGAGATAAGAGCGGGTGTGCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-805s21c1
Sequence:CCGGGAAATCTTCACAGATAGTAAGCTCGAGCTTACTATCTGTGAAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-740s21c1
Sequence:CCGGGCAAGGTACAGAGCGTGAAAGCTCGAGCTTTCACGCTCTGTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-916s21c1
Sequence:CCGGAGCCGAGAAGTAACCACATATCTCGAGATATGTGGTTACTTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-485s21c1
Sequence:CCGGTGCGGTTCTTCGACGTGTTTGCTCGAGCAAACACGTCGAAGAACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028357.1-1225s1c1
Sequence:CCGGGCTATGTGATTTATGACTGTACTCGAGTACAGTCATAAATCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028357.1-987s1c1
Sequence:CCGGGCCAGTGTCAACAAAGAGGAACTCGAGTTCCTCTTTGTTGACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028357.1-632s1c1
Sequence:CCGGGAAGTTCATCAAGAGGTGGAACTCGAGTTCCACCTCTTGATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028357
VEPH1 MISSION shRNA shRNA Plasmid DNA
ventricular zone expressed PH domain-containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028357.3-944s21c1
Sequence:CCGGGATTCGCACACCCGCTCTTATCTCGAGATAAGAGCGGGTGTGCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-805s21c1
Sequence:CCGGGAAATCTTCACAGATAGTAAGCTCGAGCTTACTATCTGTGAAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-740s21c1
Sequence:CCGGGCAAGGTACAGAGCGTGAAAGCTCGAGCTTTCACGCTCTGTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-916s21c1
Sequence:CCGGAGCCGAGAAGTAACCACATATCTCGAGATATGTGGTTACTTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-485s21c1
Sequence:CCGGTGCGGTTCTTCGACGTGTTTGCTCGAGCAAACACGTCGAAGAACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028357.1-1225s1c1
Sequence:CCGGGCTATGTGATTTATGACTGTACTCGAGTACAGTCATAAATCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028357.1-987s1c1
Sequence:CCGGGCCAGTGTCAACAAAGAGGAACTCGAGTTCCTCTTTGTTGACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028357.1-632s1c1
Sequence:CCGGGAAGTTCATCAAGAGGTGGAACTCGAGTTCCACCTCTTGATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028357
VEPH1 MISSION shRNA Lentiviral Transduction Particles
ventricular zone expressed PH domain-containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028357.3-944s21c1
Sequence:CCGGGATTCGCACACCCGCTCTTATCTCGAGATAAGAGCGGGTGTGCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-805s21c1
Sequence:CCGGGAAATCTTCACAGATAGTAAGCTCGAGCTTACTATCTGTGAAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-740s21c1
Sequence:CCGGGCAAGGTACAGAGCGTGAAAGCTCGAGCTTTCACGCTCTGTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-916s21c1
Sequence:CCGGAGCCGAGAAGTAACCACATATCTCGAGATATGTGGTTACTTCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028357.3-485s21c1
Sequence:CCGGTGCGGTTCTTCGACGTGTTTGCTCGAGCAAACACGTCGAAGAACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200733    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028357.1-1225s1c1
Sequence:CCGGGCTATGTGATTTATGACTGTACTCGAGTACAGTCATAAATCACATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028357.1-987s1c1
Sequence:CCGGGCCAGTGTCAACAAAGAGGAACTCGAGTTCCTCTTTGTTGACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028357.1-632s1c1
Sequence:CCGGGAAGTTCATCAAGAGGTGGAACTCGAGTTCCACCTCTTGATGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks