EMAIL THIS PAGE TO A FRIEND

VEZF1

vascular endothelial zinc finger 1

Synonyms: DB1 ZNF161
UniProtKB ID: Q14119
Gene ID:
Human(7716) Summary: Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]
Mouse(22344) vascular endothelial zinc finger 1
Rat(287615) vascular endothelial zinc finger 1
chicken(417664) vascular endothelial zinc finger 1
dog(491106) vascular endothelial zinc finger 1
domestic cat(101083632) vascular endothelial zinc finger 1
domestic guinea pig(100722246) vascular endothelial zinc finger 1
naked mole-rat(101715042) vascular endothelial zinc finger 1
cow(539120) vascular endothelial zinc finger 1
sheep(101120760) vascular endothelial zinc finger 1
247 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102675 Anti-VEZF1 antibody produced in rabbit affinity isolated antibody mouse, rabbit, canine, human, horse, bovine, zebrafish, rat, guinea pig
western blot pricing
HPA027520 Anti-VEZF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007146 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015871 MISSION® esiRNA esiRNA targeting human VEZF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007146 Rosetta Predictions human pricing
XM_001081191 Rosetta Predictions rat pricing
XM_213421 Rosetta Predictions rat pricing
NM_016686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343037 predicted 1410
2 SASI_Hs02_00343038 predicted 1462
3 SASI_Hs02_00343039 predicted 791
4 SASI_Hs02_00343040 predicted 363
5 SASI_Hs01_00151135 predicted 1648
6 SASI_Hs02_00343041 predicted 1421
7 SASI_Hs02_00343042 predicted 793
8 SASI_Hs02_00343043 predicted 372
9 SASI_Hs02_00343044 predicted 1789
10 SASI_Hs02_00343045 predicted 1684
11 SASI_Hs01_00151136 predicted 1648
12 SASI_Hs01_00151137 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370960 predicted 465
2 SASI_Rn02_00370961 predicted 1794
3 SASI_Rn02_00370962 predicted 1474
4 SASI_Rn02_00370963 predicted 1589
5 SASI_Rn02_00370964 predicted 1261
6 SASI_Rn02_00370965 predicted 199
7 SASI_Rn02_00370966 predicted 1240
8 SASI_Rn02_00370967 predicted 1614
9 SASI_Rn02_00370968 predicted 343
10 SASI_Rn02_00370969 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374589 predicted 467
2 SASI_Rn02_00374590 predicted 1794
3 SASI_Rn02_00374591 predicted 1474
4 SASI_Rn02_00374592 predicted 1589
5 SASI_Rn02_00374593 predicted 1261
6 SASI_Rn02_00374594 predicted 200
7 SASI_Rn02_00374595 predicted 1244
8 SASI_Rn02_00374596 predicted 1618
9 SASI_Rn02_00374597 predicted 349
10 SASI_Rn02_00374598 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091726 predicted 1316
2 SASI_Mm01_00091727 predicted 1656
3 SASI_Mm01_00091728 predicted 1544
4 SASI_Mm01_00091729 predicted 1695
5 SASI_Mm02_00323340 predicted 1663
6 SASI_Mm01_00091730 predicted 268
7 SASI_Mm01_00091731 predicted 712
8 SASI_Mm01_00091732 predicted 285
9 SASI_Mm01_00091733 predicted 1366
10 SASI_Mm01_00091734 predicted 308
11 SASI_Mm01_00091725 predicted 1731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016686
VALIDATED
VEZF1 MISSION shRNA Bacterial Glycerol Stock
vascular endothelial zinc finger 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.2-971s1c1
Sequence:CCGGCGAAGGCAAGGTATCATGTAACTCGAGTTACATGATACCTTGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.2-291s1c1
Sequence:CCGGGAAACATTAAAGGATGCCATTCTCGAGAATGGCATCCTTTAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016686.2-1863s1c1
Sequence:CCGGCCACTTTAGTTTACTCAGAAACTCGAGTTTCTGAGTAAACTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016686.3-2083s21c1
Sequence:CCGGACAGAGGCATTGTCATAATAACTCGAGTTATTATGACAATGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-660s21c1
Sequence:CCGGGCCCTTTGAGTGTCCTATTTGCTCGAGCAAATAGGACACTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.3-185s1c1
Sequence:CCGGCGTTGCTTCCAATACCAATTACTCGAGTAATTGGTATTGGAAGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.3-437s1c1
Sequence:CCGGCTTCGTTGGTTTCAACTATTGCTCGAGCAATAGTTGAAACCAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-1376s21c1
Sequence:CCGGTAGGGCATCCCGTAACCATAACTCGAGTTATGGTTACGGGATGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-942s21c1
Sequence:CCGGGCTCTTGAGTGCAGCATATATCTCGAGATATATGCTGCACTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-1513s21c1
Sequence:CCGGCTGCCCACTCCTATGACATTACTCGAGTAATGTCATAGGAGTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016686
VALIDATED
VEZF1 MISSION shRNA shRNA Plasmid DNA
vascular endothelial zinc finger 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.2-971s1c1
Sequence:CCGGCGAAGGCAAGGTATCATGTAACTCGAGTTACATGATACCTTGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.2-291s1c1
Sequence:CCGGGAAACATTAAAGGATGCCATTCTCGAGAATGGCATCCTTTAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016686.2-1863s1c1
Sequence:CCGGCCACTTTAGTTTACTCAGAAACTCGAGTTTCTGAGTAAACTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016686.3-2083s21c1
Sequence:CCGGACAGAGGCATTGTCATAATAACTCGAGTTATTATGACAATGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-660s21c1
Sequence:CCGGGCCCTTTGAGTGTCCTATTTGCTCGAGCAAATAGGACACTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.3-185s1c1
Sequence:CCGGCGTTGCTTCCAATACCAATTACTCGAGTAATTGGTATTGGAAGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.3-437s1c1
Sequence:CCGGCTTCGTTGGTTTCAACTATTGCTCGAGCAATAGTTGAAACCAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-1376s21c1
Sequence:CCGGTAGGGCATCCCGTAACCATAACTCGAGTTATGGTTACGGGATGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-942s21c1
Sequence:CCGGGCTCTTGAGTGCAGCATATATCTCGAGATATATGCTGCACTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-1513s21c1
Sequence:CCGGCTGCCCACTCCTATGACATTACTCGAGTAATGTCATAGGAGTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016686
VALIDATED
VEZF1 MISSION shRNA Lentiviral Transduction Particles
vascular endothelial zinc finger 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.2-971s1c1
Sequence:CCGGCGAAGGCAAGGTATCATGTAACTCGAGTTACATGATACCTTGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.2-291s1c1
Sequence:CCGGGAAACATTAAAGGATGCCATTCTCGAGAATGGCATCCTTTAATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184997    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016686.2-1863s1c1
Sequence:CCGGCCACTTTAGTTTACTCAGAAACTCGAGTTTCTGAGTAAACTAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016686.3-2083s21c1
Sequence:CCGGACAGAGGCATTGTCATAATAACTCGAGTTATTATGACAATGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-660s21c1
Sequence:CCGGGCCCTTTGAGTGTCCTATTTGCTCGAGCAAATAGGACACTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.3-185s1c1
Sequence:CCGGCGTTGCTTCCAATACCAATTACTCGAGTAATTGGTATTGGAAGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016686.3-437s1c1
Sequence:CCGGCTTCGTTGGTTTCAACTATTGCTCGAGCAATAGTTGAAACCAACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-1376s21c1
Sequence:CCGGTAGGGCATCCCGTAACCATAACTCGAGTTATGGTTACGGGATGCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-942s21c1
Sequence:CCGGGCTCTTGAGTGCAGCATATATCTCGAGATATATGCTGCACTCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016686.3-1513s21c1
Sequence:CCGGCTGCCCACTCCTATGACATTACTCGAGTAATGTCATAGGAGTGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007146
VALIDATED
VEZF1 MISSION shRNA Bacterial Glycerol Stock
vascular endothelial zinc finger 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007146.1-1848s1c1
Sequence:CCGGGCAAGATGAAATGCCAGAATTCTCGAGAATTCTGGCATTTCATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007146.1-591s1c1
Sequence:CCGGCGAGATGTGTACCATCTCAATCTCGAGATTGAGATGGTACACATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_007146.1-174s1c1
Sequence:CCGGCCAATACCAATAACTCAGAAACTCGAGTTTCTGAGTTATTGGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007146.1-1480s1c1
Sequence:CCGGCAATGAATCTACCCACACCTACTCGAGTAGGTGTGGGTAGATTCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007146.1-1112s1c1
Sequence:CCGGGCAAGTAGAAACACTCAGACTCTCGAGAGTCTGAGTGTTTCTACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-268s21c1
Sequence:CCGGCATTGCTTCCAATACCAATAACTCGAGTTATTGGTATTGGAAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-1480s21c1
Sequence:CCGGTAACTATAACCAGTCCATTATCTCGAGATAATGGACTGGTTATAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-2566s21c1
Sequence:GTACCGGGTACTTTGGAACAGTACAAATCTCGAGATTTGTACTGTTCCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007146.2-1605s21c1
Sequence:CCGGCTACCCACACCTATGACATTACTCGAGTAATGTCATAGGTGTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-743s21c1
Sequence:CCGGACCCTTTGAGTGTCCTATTTGCTCGAGCAAATAGGACACTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007146
VALIDATED
VEZF1 MISSION shRNA shRNA Plasmid DNA
vascular endothelial zinc finger 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007146.1-1848s1c1
Sequence:CCGGGCAAGATGAAATGCCAGAATTCTCGAGAATTCTGGCATTTCATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007146.1-591s1c1
Sequence:CCGGCGAGATGTGTACCATCTCAATCTCGAGATTGAGATGGTACACATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_007146.1-174s1c1
Sequence:CCGGCCAATACCAATAACTCAGAAACTCGAGTTTCTGAGTTATTGGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007146.1-1480s1c1
Sequence:CCGGCAATGAATCTACCCACACCTACTCGAGTAGGTGTGGGTAGATTCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007146.1-1112s1c1
Sequence:CCGGGCAAGTAGAAACACTCAGACTCTCGAGAGTCTGAGTGTTTCTACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-268s21c1
Sequence:CCGGCATTGCTTCCAATACCAATAACTCGAGTTATTGGTATTGGAAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-1480s21c1
Sequence:CCGGTAACTATAACCAGTCCATTATCTCGAGATAATGGACTGGTTATAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-2566s21c1
Sequence:GTACCGGGTACTTTGGAACAGTACAAATCTCGAGATTTGTACTGTTCCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007146.2-1605s21c1
Sequence:CCGGCTACCCACACCTATGACATTACTCGAGTAATGTCATAGGTGTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-743s21c1
Sequence:CCGGACCCTTTGAGTGTCCTATTTGCTCGAGCAAATAGGACACTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007146
VALIDATED
VEZF1 MISSION shRNA Lentiviral Transduction Particles
vascular endothelial zinc finger 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012973    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007146.1-1848s1c1
Sequence:CCGGGCAAGATGAAATGCCAGAATTCTCGAGAATTCTGGCATTTCATCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007146.1-591s1c1
Sequence:CCGGCGAGATGTGTACCATCTCAATCTCGAGATTGAGATGGTACACATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_007146.1-174s1c1
Sequence:CCGGCCAATACCAATAACTCAGAAACTCGAGTTTCTGAGTTATTGGTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007146.1-1480s1c1
Sequence:CCGGCAATGAATCTACCCACACCTACTCGAGTAGGTGTGGGTAGATTCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007146.1-1112s1c1
Sequence:CCGGGCAAGTAGAAACACTCAGACTCTCGAGAGTCTGAGTGTTTCTACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-268s21c1
Sequence:CCGGCATTGCTTCCAATACCAATAACTCGAGTTATTGGTATTGGAAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-1480s21c1
Sequence:CCGGTAACTATAACCAGTCCATTATCTCGAGATAATGGACTGGTTATAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-2566s21c1
Sequence:GTACCGGGTACTTTGGAACAGTACAAATCTCGAGATTTGTACTGTTCCAAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007146.2-1605s21c1
Sequence:CCGGCTACCCACACCTATGACATTACTCGAGTAATGTCATAGGTGTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_007146.2-743s21c1
Sequence:CCGGACCCTTTGAGTGTCCTATTTGCTCGAGCAAATAGGACACTCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks