EMAIL THIS PAGE TO A FRIEND

VEZT

vezatin, adherens junctions transmembrane protein

Synonyms: VEZATIN
Gene ID:
Human(55591) Summary: This gene encodes a transmembrane protein which has been localized to adherens junctions and shown to bind to myosin VIIA. Examination of expression of this gene in gastric cancer tissues have shown that expression is decreased which appears to be related to hypermethylation of the promoter. Expression of this gene may also be inhibited by binding of a specific microRNA to a target sequence in the 3' UTR of the transcripts. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
Mouse(215008) vezatin, adherens junctions transmembrane protein
Rat(299738) vezatin, adherens junctions transmembrane protein
chicken(417911) vezatin, adherens junctions transmembrane protein
dog(612906) vezatin, adherens junctions transmembrane protein
Horse(100065252) vezatin, adherens junctions transmembrane protein
domestic cat(101082419) vezatin, adherens junctions transmembrane protein
cow(535351) vezatin, adherens junctions transmembrane protein
sheep(101116300) vezatin, adherens junctions transmembrane protein
naked mole-rat(101706457) vezatin, adherens junctions transmembrane protein
Domestic Rabbit(100347395) vezatin, adherens junctions transmembrane protein
domestic guinea pig(100725056) vezatin, adherens junctions transmembrane protein
183 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017599 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069961 MISSION® esiRNA esiRNA human VEZT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017599 Rosetta Predictions human pricing
NM_001006984 Rosetta Predictions rat pricing
NM_172538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150148 predicted 1406
2 SASI_Hs01_00150149 predicted 1647
3 SASI_Hs01_00150151 predicted 1216
4 SASI_Hs02_00350269 predicted 1807
5 SASI_Hs02_00350270 predicted 1576
6 SASI_Hs01_00150155 predicted 719
7 SASI_Hs02_00350271 predicted 1905
8 SASI_Hs02_00350272 predicted 2336
9 SASI_Hs01_00150156 predicted 910
10 SASI_Hs02_00350273 predicted 2355
11 SASI_Hs01_00150150 predicted 1511
12 SASI_Hs01_00150152 predicted 591
13 SASI_Hs01_00150153 predicted 1625
14 SASI_Hs01_00150154 predicted 486
15 SASI_Hs01_00150157 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087559 predicted 947
2 SASI_Rn01_00087560 predicted 1956
3 SASI_Rn01_00087562 predicted 1631
4 SASI_Rn01_00087563 predicted 1702
5 SASI_Rn01_00087564 predicted 1944
6 SASI_Rn01_00087565 predicted 281
7 SASI_Rn01_00087566 predicted 997
8 SASI_Rn01_00087567 predicted 1493
9 SASI_Rn01_00087568 predicted 1382
10 SASI_Rn02_00198556 predicted 730
11 SASI_Rn01_00087561 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159110 predicted 1120
2 SASI_Mm01_00159111 predicted 924
3 SASI_Mm01_00159113 predicted 2343
4 SASI_Mm01_00159114 predicted 966
5 SASI_Mm01_00159115 predicted 1711
6 SASI_Mm01_00159116 predicted 1329
7 SASI_Mm01_00159117 predicted 238
8 SASI_Mm01_00159118 predicted 1914
9 SASI_Mm01_00159119 predicted 1150
10 SASI_Mm02_00344148 predicted 667
11 SASI_Mm01_00159112 predicted 1676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017599
VALIDATED
VEZT MISSION shRNA Bacterial Glycerol Stock
vezatin, adherens junctions transmembrane protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017599.3-2077s21c1
Sequence:CCGGATAAGTAGGACTGAGTATTTACTCGAGTAAATACTCAGTCCTACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017599.3-922s21c1
Sequence:CCGGGCAAGGCTAGCTACCCTATATCTCGAGATATAGGGTAGCTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017599.3-350s21c1
Sequence:CCGGTACTTCACAAGTTGGATATTGCTCGAGCAATATCCAACTTGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017599.3-1142s21c1
Sequence:CCGGTCAGACGGTTAGCCCTATTACCTCGAGGTAATAGGGCTAACCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017599.3-2985s21c1
Sequence:CCGGAGTGCGTGGGTTATGACATTTCTCGAGAAATGTCATAACCCACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017599.2-1746s1c1
Sequence:CCGGCAGAAGCGTGAGCATGAAGAACTCGAGTTCTTCATGCTCACGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017599.2-604s1c1
Sequence:CCGGCCAAACTACAAGTGACCCTAACTCGAGTTAGGGTCACTTGTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_017599.2-3057s1c1
Sequence:CCGGGCCACAACAGACAATGAAATACTCGAGTATTTCATTGTCTGTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017599.2-1337s1c1
Sequence:CCGGCCATCTGAAAGCATTACTGAACTCGAGTTCAGTAATGCTTTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_017599.2-487s1c1
Sequence:CCGGCCTTCATTAGCTTGCTCGTTACTCGAGTAACGAGCAAGCTAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017599
VALIDATED
VEZT MISSION shRNA shRNA Plasmid DNA
vezatin, adherens junctions transmembrane protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017599.3-2077s21c1
Sequence:CCGGATAAGTAGGACTGAGTATTTACTCGAGTAAATACTCAGTCCTACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017599.3-922s21c1
Sequence:CCGGGCAAGGCTAGCTACCCTATATCTCGAGATATAGGGTAGCTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017599.3-350s21c1
Sequence:CCGGTACTTCACAAGTTGGATATTGCTCGAGCAATATCCAACTTGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017599.3-1142s21c1
Sequence:CCGGTCAGACGGTTAGCCCTATTACCTCGAGGTAATAGGGCTAACCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017599.3-2985s21c1
Sequence:CCGGAGTGCGTGGGTTATGACATTTCTCGAGAAATGTCATAACCCACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017599.2-1746s1c1
Sequence:CCGGCAGAAGCGTGAGCATGAAGAACTCGAGTTCTTCATGCTCACGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017599.2-604s1c1
Sequence:CCGGCCAAACTACAAGTGACCCTAACTCGAGTTAGGGTCACTTGTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_017599.2-3057s1c1
Sequence:CCGGGCCACAACAGACAATGAAATACTCGAGTATTTCATTGTCTGTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017599.2-1337s1c1
Sequence:CCGGCCATCTGAAAGCATTACTGAACTCGAGTTCAGTAATGCTTTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_017599.2-487s1c1
Sequence:CCGGCCTTCATTAGCTTGCTCGTTACTCGAGTAACGAGCAAGCTAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017599
VALIDATED
VEZT MISSION shRNA Lentiviral Transduction Particles
vezatin, adherens junctions transmembrane protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017599.3-2077s21c1
Sequence:CCGGATAAGTAGGACTGAGTATTTACTCGAGTAAATACTCAGTCCTACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017599.3-922s21c1
Sequence:CCGGGCAAGGCTAGCTACCCTATATCTCGAGATATAGGGTAGCTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017599.3-350s21c1
Sequence:CCGGTACTTCACAAGTTGGATATTGCTCGAGCAATATCCAACTTGTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017599.3-1142s21c1
Sequence:CCGGTCAGACGGTTAGCCCTATTACCTCGAGGTAATAGGGCTAACCGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017599.3-2985s21c1
Sequence:CCGGAGTGCGTGGGTTATGACATTTCTCGAGAAATGTCATAACCCACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017599.2-1746s1c1
Sequence:CCGGCAGAAGCGTGAGCATGAAGAACTCGAGTTCTTCATGCTCACGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017599.2-604s1c1
Sequence:CCGGCCAAACTACAAGTGACCCTAACTCGAGTTAGGGTCACTTGTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_017599.2-3057s1c1
Sequence:CCGGGCCACAACAGACAATGAAATACTCGAGTATTTCATTGTCTGTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017599.2-1337s1c1
Sequence:CCGGCCATCTGAAAGCATTACTGAACTCGAGTTCAGTAATGCTTTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_017599.2-487s1c1
Sequence:CCGGCCTTCATTAGCTTGCTCGTTACTCGAGTAACGAGCAAGCTAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172538
VALIDATED
VEZT MISSION shRNA Bacterial Glycerol Stock
vezatin, adherens junctions transmembrane protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172538.2-500s1c1
Sequence:CCGGCTTCATTAGTTTGCTCATCATCTCGAGATGATGAGCAAACTAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172538.2-3338s1c1
Sequence:CCGGCCAGACTTTATAGGCATTCTTCTCGAGAAGAATGCCTATAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172538.2-870s1c1
Sequence:CCGGGCTACCTTGTACATGCTGAAACTCGAGTTTCAGCATGTACAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172538.2-2492s1c1
Sequence:CCGGGCGTGAATTTACAGGGTGAATCTCGAGATTCACCCTGTAAATTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172538
VALIDATED
VEZT MISSION shRNA shRNA Plasmid DNA
vezatin, adherens junctions transmembrane protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172538.2-500s1c1
Sequence:CCGGCTTCATTAGTTTGCTCATCATCTCGAGATGATGAGCAAACTAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172538.2-3338s1c1
Sequence:CCGGCCAGACTTTATAGGCATTCTTCTCGAGAAGAATGCCTATAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172538.2-870s1c1
Sequence:CCGGGCTACCTTGTACATGCTGAAACTCGAGTTTCAGCATGTACAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172538.2-2492s1c1
Sequence:CCGGGCGTGAATTTACAGGGTGAATCTCGAGATTCACCCTGTAAATTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172538
VALIDATED
VEZT MISSION shRNA Lentiviral Transduction Particles
vezatin, adherens junctions transmembrane protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172538.2-500s1c1
Sequence:CCGGCTTCATTAGTTTGCTCATCATCTCGAGATGATGAGCAAACTAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172538.2-3338s1c1
Sequence:CCGGCCAGACTTTATAGGCATTCTTCTCGAGAAGAATGCCTATAAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172538.2-870s1c1
Sequence:CCGGGCTACCTTGTACATGCTGAAACTCGAGTTTCAGCATGTACAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172538.2-2492s1c1
Sequence:CCGGGCGTGAATTTACAGGGTGAATCTCGAGATTCACCCTGTAAATTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks