EMAIL THIS PAGE TO A FRIEND

VGF

VGF nerve growth factor inducible

UniProtKB ID: O15240, Q9UDW8
Gene ID:
Human(7425) Summary: This gene is specifically expressed in a subpopulation of neuroendocrine cells, and is upregulated by nerve growth factor. The structural organization of this gene is similar to that of the rat gene, and both the translated and the untranslated regions show a high degree of sequence similarity to the rat gene. The encoded secretory protein also shares similarities with the secretogranin/chromogranin family, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Mouse(381677) VGF nerve growth factor inducible
Rat(29461) VGF nerve growth factor inducible
dog(100687924) VGF nerve growth factor inducible
domestic cat(101088900) VGF nerve growth factor inducible
domestic guinea pig(100734351) VGF nerve growth factor inducible
sheep(101119872) VGF nerve growth factor inducible
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0567 AQUA Peptide GLQEAAEE[R] human pricing
AQ0574 AQUA Peptide GAAPPG[V]TR human, mouse, rat pricing
AQ0569 AQUA Peptide AQVEAG[R] human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003378 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU216931 MISSION® esiRNA esiRNA targeting mouse Vgf mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003378 Rosetta Predictions human pricing
NM_030997 Rosetta Predictions rat pricing
NM_001039385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133790 predicted 628
2 SASI_Hs01_00133791 predicted 347
3 SASI_Hs01_00133792 predicted 382
4 SASI_Hs01_00133793 predicted 215
5 SASI_Hs01_00133794 predicted 380
6 SASI_Hs01_00133795 predicted 413
7 SASI_Hs01_00133796 predicted 569
8 SASI_Hs01_00133797 predicted 417
9 SASI_Hs01_00133798 predicted 626
10 SASI_Hs01_00133799 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067391 predicted 818
2 SASI_Rn01_00067392 predicted 818
3 SASI_Rn01_00067393 predicted 2315
4 SASI_Rn01_00067394 predicted 646
5 SASI_Rn01_00067395 predicted 1111
6 SASI_Rn01_00067396 predicted 496
7 SASI_Rn01_00067397 predicted 2368
8 SASI_Rn01_00067398 predicted 331
9 SASI_Rn01_00067399 predicted 1105
10 SASI_Rn02_00264170 predicted 397
11 SASI_Rn01_00067390 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150584 predicted 973
2 SASI_Mm01_00150585 predicted 518
3 SASI_Mm02_00290025 predicted 1691
4 SASI_Mm01_00150586 predicted 661
5 SASI_Mm01_00150587 predicted 692
6 SASI_Mm01_00150589 predicted 706
7 SASI_Mm01_00150590 predicted 2281
8 SASI_Mm01_00150591 predicted 209
9 SASI_Mm01_00150592 predicted 986
10 SASI_Mm01_00150593 predicted 1862
11 SASI_Mm01_00150588 predicted 1599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003378
VGF MISSION shRNA Bacterial Glycerol Stock
VGF nerve growth factor inducible
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-257s1c1
Sequence:CCGGCTTCTGCTGATCAACGGGTTACTCGAGTAACCCGTTGATCAGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-710s1c1
Sequence:CCGGGAACTGCGAGATTTCAGTCCACTCGAGTGGACTGAAATCTCGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-250s1c1
Sequence:CCGGCTTCTGCCTTCTGCTGATCAACTCGAGTTGATCAGCAGAAGGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-2029s1c1
Sequence:CCGGGAATTACATCGAGCACGTGCTCTCGAGAGCACGTGCTCGATGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003378.3-787s21c1
Sequence:CCGGACACGCTGACCCGAGTGAATCCTCGAGGATTCACTCGGGTCAGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003378.3-321s21c1
Sequence:CCGGCTCAGCTCTGAGCATAAAGAGCTCGAGCTCTTTATGCTCAGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003378.3-1568s21c1
Sequence:CCGGGACGATCGACAGCCTCATTGACTCGAGTCAATGAGGCTGTCGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003378
VGF MISSION shRNA shRNA Plasmid DNA
VGF nerve growth factor inducible
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-257s1c1
Sequence:CCGGCTTCTGCTGATCAACGGGTTACTCGAGTAACCCGTTGATCAGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-710s1c1
Sequence:CCGGGAACTGCGAGATTTCAGTCCACTCGAGTGGACTGAAATCTCGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-250s1c1
Sequence:CCGGCTTCTGCCTTCTGCTGATCAACTCGAGTTGATCAGCAGAAGGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-2029s1c1
Sequence:CCGGGAATTACATCGAGCACGTGCTCTCGAGAGCACGTGCTCGATGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003378.3-787s21c1
Sequence:CCGGACACGCTGACCCGAGTGAATCCTCGAGGATTCACTCGGGTCAGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003378.3-321s21c1
Sequence:CCGGCTCAGCTCTGAGCATAAAGAGCTCGAGCTCTTTATGCTCAGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003378.3-1568s21c1
Sequence:CCGGGACGATCGACAGCCTCATTGACTCGAGTCAATGAGGCTGTCGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003378
VGF MISSION shRNA Lentiviral Transduction Particles
VGF nerve growth factor inducible
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-257s1c1
Sequence:CCGGCTTCTGCTGATCAACGGGTTACTCGAGTAACCCGTTGATCAGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-710s1c1
Sequence:CCGGGAACTGCGAGATTTCAGTCCACTCGAGTGGACTGAAATCTCGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180034    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-250s1c1
Sequence:CCGGCTTCTGCCTTCTGCTGATCAACTCGAGTTGATCAGCAGAAGGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003378.2-2029s1c1
Sequence:CCGGGAATTACATCGAGCACGTGCTCTCGAGAGCACGTGCTCGATGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003378.3-787s21c1
Sequence:CCGGACACGCTGACCCGAGTGAATCCTCGAGGATTCACTCGGGTCAGCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003378.3-321s21c1
Sequence:CCGGCTCAGCTCTGAGCATAAAGAGCTCGAGCTCTTTATGCTCAGAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003378.3-1568s21c1
Sequence:CCGGGACGATCGACAGCCTCATTGACTCGAGTCAATGAGGCTGTCGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039385
VGF MISSION shRNA Bacterial Glycerol Stock
VGF nerve growth factor inducible
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-1548s1c1
Sequence:CCGGAGACGATCGATAGTCTCATTGCTCGAGCAATGAGACTATCGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039385.1-2375s1c1
Sequence:CCGGGACGGGAAAGGCTGTTCTATTCTCGAGAATAGAACAGCCTTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-972s1c1
Sequence:CCGGGTGAGACTTTGACACCCTTATCTCGAGATAAGGGTGTCAAAGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-683s1c1
Sequence:CCGGCTCCAAGAACTTCGAGATTTCCTCGAGGAAATCTCGAAGTTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-881s1c1
Sequence:CCGGTCCCAATTCCAGGCTCGAATGCTCGAGCATTCGAGCCTGGAATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039385
VGF MISSION shRNA shRNA Plasmid DNA
VGF nerve growth factor inducible
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-1548s1c1
Sequence:CCGGAGACGATCGATAGTCTCATTGCTCGAGCAATGAGACTATCGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039385.1-2375s1c1
Sequence:CCGGGACGGGAAAGGCTGTTCTATTCTCGAGAATAGAACAGCCTTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-972s1c1
Sequence:CCGGGTGAGACTTTGACACCCTTATCTCGAGATAAGGGTGTCAAAGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-683s1c1
Sequence:CCGGCTCCAAGAACTTCGAGATTTCCTCGAGGAAATCTCGAAGTTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-881s1c1
Sequence:CCGGTCCCAATTCCAGGCTCGAATGCTCGAGCATTCGAGCCTGGAATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039385
VGF MISSION shRNA Lentiviral Transduction Particles
VGF nerve growth factor inducible
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-1548s1c1
Sequence:CCGGAGACGATCGATAGTCTCATTGCTCGAGCAATGAGACTATCGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219515    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001039385.1-2375s1c1
Sequence:CCGGGACGGGAAAGGCTGTTCTATTCTCGAGAATAGAACAGCCTTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-972s1c1
Sequence:CCGGGTGAGACTTTGACACCCTTATCTCGAGATAAGGGTGTCAAAGTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-683s1c1
Sequence:CCGGCTCCAAGAACTTCGAGATTTCCTCGAGGAAATCTCGAAGTTCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001039385.1-881s1c1
Sequence:CCGGTCCCAATTCCAGGCTCGAATGCTCGAGCATTCGAGCCTGGAATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks