EMAIL THIS PAGE TO A FRIEND

VGLL1

vestigial like 1 (Drosophila)

Synonyms: TDU VGL1
UniProtKB ID: Q99990, Q5H915
Gene ID:
Human(51442) Summary: The protein encoded by this gene binds proteins of the TEA domain family of transcription factors (TEFs) through the Vg (vestigial) homology region found in its N-terminus. It may thus function as a specific coactivator for the mammalian TEFs. [provided by RefSeq, Sep 2009]
Mouse(170828) vestigial like 1 homolog (Drosophila)
Rat(363508) vestigial like 1 (Drosophila)
cow(613549) vestigial like 1 (Drosophila)
sheep(101117226) vestigial like 1 (Drosophila)
domestic guinea pig(100719298) vestigial like 1 (Drosophila)
naked mole-rat(101714456) vestigial like 1 (Drosophila)
chicken(770844) vestigial like 1 (Drosophila)
domestic cat(101083661) vestigial like 1 (Drosophila)
dog(492164) vestigial like 1 (Drosophila)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016267 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042561 MISSION® esiRNA esiRNA human VGLL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016267 Rosetta Predictions human pricing
XM_001058701 Rosetta Predictions rat pricing
XM_343832 Rosetta Predictions rat pricing
NM_133251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103814 predicted 714
2 SASI_Hs01_00103815 predicted 934
3 SASI_Hs01_00103818 predicted 233
4 SASI_Hs01_00103819 predicted 430
5 SASI_Hs02_00349165 predicted 824
6 SASI_Hs01_00103820 predicted 488
7 SASI_Hs01_00103821 predicted 810
8 SASI_Hs02_00349166 predicted 833
9 SASI_Hs02_00349167 predicted 205
10 SASI_Hs02_00349168 predicted 918
11 SASI_Hs01_00103816 predicted 838
12 SASI_Hs01_00103817 predicted 754
13 SASI_Hs01_00103822 predicted 306
14 SASI_Hs01_00103823 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290578 predicted 549
2 SASI_Rn02_00290579 predicted 611
3 SASI_Rn02_00290580 predicted 707
4 SASI_Rn02_00290581 predicted 236
5 SASI_Rn02_00290582 predicted 442
6 SASI_Rn02_00290583 predicted 297
7 SASI_Rn02_00290584 predicted 750
8 SASI_Rn02_00290585 predicted 244
9 SASI_Rn02_00290586 predicted 574
10 SASI_Rn02_00290587 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396399 predicted 548
2 SASI_Rn02_00396400 predicted 609
3 SASI_Rn02_00396401 predicted 711
4 SASI_Rn02_00396402 predicted 242
5 SASI_Rn02_00396403 predicted 436
6 SASI_Rn02_00396404 predicted 292
7 SASI_Rn02_00396405 predicted 744
8 SASI_Rn02_00396406 predicted 251
9 SASI_Rn02_00396407 predicted 573
10 SASI_Rn02_00396408 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189722 predicted 372
2 SASI_Mm01_00189723 predicted 681
3 SASI_Mm01_00189724 predicted 693
4 SASI_Mm01_00189725 predicted 701
5 SASI_Mm01_00189726 predicted 957
6 SASI_Mm01_00189727 predicted 500
7 SASI_Mm01_00189729 predicted 434
8 SASI_Mm01_00189730 predicted 523
9 SASI_Mm01_00189731 predicted 419
10 SASI_Mm02_00338505 predicted 373
11 SASI_Mm01_00189728 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016267
VGLL1 MISSION shRNA Bacterial Glycerol Stock
vestigial like 1 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016267.3-788s21c1
Sequence:CCGGTCCCGGCTCAGTTCACTATAACTCGAGTTATAGTGAACTGAGCCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016267.3-1059s21c1
Sequence:CCGGTGTTAAACAGCTTCGTGTCTACTCGAGTAGACACGAAGCTGTTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016267.3-414s21c1
Sequence:CCGGTACTCGTCTCCATGGACAAAGCTCGAGCTTTGTCCATGGAGACGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-221s1c1
Sequence:CCGGGCCTATAAAGACGGAATGGAACTCGAGTTCCATTCCGTCTTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-205s1c1
Sequence:CCGGCCAAAGGCAAACAGAAGCCTACTCGAGTAGGCTTCTGTTTGCCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-877s1c1
Sequence:CCGGCACCTGGGAAATACTCACTTACTCGAGTAAGTGAGTATTTCCCAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-844s1c1
Sequence:CCGGGCCTTCCAAATGAAACTCTTTCTCGAGAAAGAGTTTCATTTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016267
VGLL1 MISSION shRNA shRNA Plasmid DNA
vestigial like 1 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016267.3-788s21c1
Sequence:CCGGTCCCGGCTCAGTTCACTATAACTCGAGTTATAGTGAACTGAGCCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016267.3-1059s21c1
Sequence:CCGGTGTTAAACAGCTTCGTGTCTACTCGAGTAGACACGAAGCTGTTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016267.3-414s21c1
Sequence:CCGGTACTCGTCTCCATGGACAAAGCTCGAGCTTTGTCCATGGAGACGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-221s1c1
Sequence:CCGGGCCTATAAAGACGGAATGGAACTCGAGTTCCATTCCGTCTTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-205s1c1
Sequence:CCGGCCAAAGGCAAACAGAAGCCTACTCGAGTAGGCTTCTGTTTGCCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-877s1c1
Sequence:CCGGCACCTGGGAAATACTCACTTACTCGAGTAAGTGAGTATTTCCCAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-844s1c1
Sequence:CCGGGCCTTCCAAATGAAACTCTTTCTCGAGAAAGAGTTTCATTTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016267
VGLL1 MISSION shRNA Lentiviral Transduction Particles
vestigial like 1 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016267.3-788s21c1
Sequence:CCGGTCCCGGCTCAGTTCACTATAACTCGAGTTATAGTGAACTGAGCCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016267.3-1059s21c1
Sequence:CCGGTGTTAAACAGCTTCGTGTCTACTCGAGTAGACACGAAGCTGTTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016267.3-414s21c1
Sequence:CCGGTACTCGTCTCCATGGACAAAGCTCGAGCTTTGTCCATGGAGACGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-221s1c1
Sequence:CCGGGCCTATAAAGACGGAATGGAACTCGAGTTCCATTCCGTCTTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-205s1c1
Sequence:CCGGCCAAAGGCAAACAGAAGCCTACTCGAGTAGGCTTCTGTTTGCCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-877s1c1
Sequence:CCGGCACCTGGGAAATACTCACTTACTCGAGTAAGTGAGTATTTCCCAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016267.2-844s1c1
Sequence:CCGGGCCTTCCAAATGAAACTCTTTCTCGAGAAAGAGTTTCATTTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133251
VGLL1 MISSION shRNA Bacterial Glycerol Stock
vestigial like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-685s1c1
Sequence:CCGGGCTTGGATGAATATGGTCTTACTCGAGTAAGACCATATTCATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-427s1c1
Sequence:CCGGCCCACAAATGCAGTTCCTCAACTCGAGTTGAGGAACTGCATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-957s1c1
Sequence:CCGGCTTCAACATTTAGTCCAGCAACTCGAGTTGCTGGACTAAATGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-452s1c1
Sequence:CCGGCAGTGACAATTTGACCCTCAACTCGAGTTGAGGGTCAAATTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-885s1c1
Sequence:CCGGCCAGAGGTCTACCATGTCTTTCTCGAGAAAGACATGGTAGACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133251
VGLL1 MISSION shRNA shRNA Plasmid DNA
vestigial like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-685s1c1
Sequence:CCGGGCTTGGATGAATATGGTCTTACTCGAGTAAGACCATATTCATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-427s1c1
Sequence:CCGGCCCACAAATGCAGTTCCTCAACTCGAGTTGAGGAACTGCATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-957s1c1
Sequence:CCGGCTTCAACATTTAGTCCAGCAACTCGAGTTGCTGGACTAAATGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-452s1c1
Sequence:CCGGCAGTGACAATTTGACCCTCAACTCGAGTTGAGGGTCAAATTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-885s1c1
Sequence:CCGGCCAGAGGTCTACCATGTCTTTCTCGAGAAAGACATGGTAGACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133251
VGLL1 MISSION shRNA Lentiviral Transduction Particles
vestigial like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-685s1c1
Sequence:CCGGGCTTGGATGAATATGGTCTTACTCGAGTAAGACCATATTCATCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-427s1c1
Sequence:CCGGCCCACAAATGCAGTTCCTCAACTCGAGTTGAGGAACTGCATTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-957s1c1
Sequence:CCGGCTTCAACATTTAGTCCAGCAACTCGAGTTGCTGGACTAAATGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-452s1c1
Sequence:CCGGCAGTGACAATTTGACCCTCAACTCGAGTTGAGGGTCAAATTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133251.1-885s1c1
Sequence:CCGGCCAGAGGTCTACCATGTCTTTCTCGAGAAAGACATGGTAGACCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks