EMAIL THIS PAGE TO A FRIEND

VGLL2

vestigial like 2 (Drosophila)

Synonyms: VGL2 VITO1
UniProtKB ID: Q8N8G2, Q8WWX1
Gene ID:
Human(245806) Summary: This gene encodes a protein with a transcriptional enhancer factor 1 (TEF-1) interaction domain. The encoded protein may act as a co-factor of TEF-1 regulated gene expression during skeletal muscle development. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012]
Mouse(215031) vestigial like 2 homolog (Drosophila)
Rat(309772) vestigial like 2 (Drosophila)
chicken(421735) vestigial like 2 (Drosophila)
domestic cat(101093188) vestigial like 2 (Drosophila)
dog(484097) vestigial like 2 (Drosophila)
naked mole-rat(101701783) vestigial like 2 (Drosophila)
domestic guinea pig(100724808) vestigial like 2 (Drosophila)
cow(541260) vestigial like 2 (Drosophila)
sheep(101103729) vestigial like 2 (Drosophila)
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301889 Anti-VGLL2 affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1402065 Anti-VGLL2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV50815 Anti-VGLL2 antibody produced in rabbit affinity isolated antibody mouse, rabbit, pig, guinea pig, horse, canine, bovine, zebrafish, rat, human
western blot pricing
SAB2106914 Anti-VGLL2 antibody produced in rabbit affinity isolated antibody rabbit, horse, human, mouse, guinea pig
ELISA, western blot pricing
SAB2105373 Anti-VGLL2, (C-terminal) antibody produced in rabbit affinity isolated antibody rabbit, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153453 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153453 Rosetta Predictions human pricing
NM_182645 Rosetta Predictions human pricing
NM_001107630 Rosetta Predictions rat pricing
NM_153786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143636 predicted 892
2 SASI_Hs02_00367294 predicted 1056
3 SASI_Hs01_00143638 predicted 276
4 SASI_Hs01_00143639 predicted 870
5 SASI_Hs01_00143640 predicted 217
6 SASI_Hs01_00143641 predicted 1057
7 SASI_Hs01_00143642 predicted 985
8 SASI_Hs01_00143643 predicted 1052
9 SASI_Hs02_00367295 predicted 1067
10 SASI_Hs02_00367296 predicted 906
11 SASI_Hs01_00143634 predicted 873
12 SASI_Hs01_00143635 predicted 867
13 SASI_Hs01_00143637 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095716 predicted 1404
2 SASI_Hs02_00370804 predicted 1569
3 SASI_Hs01_00095718 predicted 256
4 SASI_Hs01_00095719 predicted 1370
5 SASI_Hs01_00095720 predicted 196
6 SASI_Hs01_00095721 predicted 1558
7 SASI_Hs01_00095722 predicted 1494
8 SASI_Hs01_00095723 predicted 1555
9 SASI_Hs02_00370805 predicted 1570
10 SASI_Hs02_00370806 predicted 1411
11 SASI_Hs01_00095714 predicted 1383
12 SASI_Hs01_00095715 predicted 1376
13 SASI_Hs01_00095717 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230725 predicted 887
2 SASI_Rn02_00230726 predicted 895
3 SASI_Rn02_00230727 predicted 1365
4 SASI_Rn02_00230728 predicted 1227
5 SASI_Rn02_00230729 predicted 242
6 SASI_Rn02_00230730 predicted 1211
7 SASI_Rn02_00230731 predicted 427
8 SASI_Rn02_00230732 predicted 1301
9 SASI_Rn02_00230733 predicted 787
10 SASI_Rn02_00230734 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094843 predicted 1090
2 SASI_Mm01_00094844 predicted 1088
3 SASI_Mm01_00094845 predicted 1166
4 SASI_Mm01_00094846 predicted 284
5 SASI_Mm01_00094847 predicted 1220
6 SASI_Mm01_00094848 predicted 731
7 SASI_Mm01_00094849 predicted 1194
8 SASI_Mm01_00094850 predicted 988
9 SASI_Mm02_00343509 predicted 425
10 SASI_Mm01_00094852 predicted 737
11 SASI_Mm01_00094851 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153453
VGLL2 MISSION shRNA Bacterial Glycerol Stock
vestigial like 2 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153453.1-497s1c1
Sequence:CCGGCGTGGTGGATGAACATTTCAGCTCGAGCTGAAATGTTCATCCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153453.1-460s1c1
Sequence:CCGGGCGTCCTCTTCACTTATTTCCCTCGAGGGAAATAAGTGAAGAGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153453.1-457s1c1
Sequence:CCGGGCTGCGTCCTCTTCACTTATTCTCGAGAATAAGTGAAGAGGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153453.1-811s1c1
Sequence:CCGGCCTGCTGCTGAAAGAGCAAATCTCGAGATTTGCTCTTTCAGCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153453.1-815s1c1
Sequence:CCGGCTGCTGAAAGAGCAAATCCAACTCGAGTTGGATTTGCTCTTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153453.1-901s21c1
Sequence:CCGGTCAGGTGATGTGATATCATAACTCGAGTTATGATATCACATCACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153453.1-861s21c1
Sequence:CCGGTGGCCGAATCACTGGAAATATCTCGAGATATTTCCAGTGATTCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153453
VGLL2 MISSION shRNA shRNA Plasmid DNA
vestigial like 2 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153453.1-497s1c1
Sequence:CCGGCGTGGTGGATGAACATTTCAGCTCGAGCTGAAATGTTCATCCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153453.1-460s1c1
Sequence:CCGGGCGTCCTCTTCACTTATTTCCCTCGAGGGAAATAAGTGAAGAGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153453.1-457s1c1
Sequence:CCGGGCTGCGTCCTCTTCACTTATTCTCGAGAATAAGTGAAGAGGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153453.1-811s1c1
Sequence:CCGGCCTGCTGCTGAAAGAGCAAATCTCGAGATTTGCTCTTTCAGCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153453.1-815s1c1
Sequence:CCGGCTGCTGAAAGAGCAAATCCAACTCGAGTTGGATTTGCTCTTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153453.1-901s21c1
Sequence:CCGGTCAGGTGATGTGATATCATAACTCGAGTTATGATATCACATCACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153453.1-861s21c1
Sequence:CCGGTGGCCGAATCACTGGAAATATCTCGAGATATTTCCAGTGATTCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153453
VGLL2 MISSION shRNA Lentiviral Transduction Particles
vestigial like 2 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153453.1-497s1c1
Sequence:CCGGCGTGGTGGATGAACATTTCAGCTCGAGCTGAAATGTTCATCCACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153453.1-460s1c1
Sequence:CCGGGCGTCCTCTTCACTTATTTCCCTCGAGGGAAATAAGTGAAGAGGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153453.1-457s1c1
Sequence:CCGGGCTGCGTCCTCTTCACTTATTCTCGAGAATAAGTGAAGAGGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153453.1-811s1c1
Sequence:CCGGCCTGCTGCTGAAAGAGCAAATCTCGAGATTTGCTCTTTCAGCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153453.1-815s1c1
Sequence:CCGGCTGCTGAAAGAGCAAATCCAACTCGAGTTGGATTTGCTCTTTCAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153453.1-901s21c1
Sequence:CCGGTCAGGTGATGTGATATCATAACTCGAGTTATGATATCACATCACCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153453.1-861s21c1
Sequence:CCGGTGGCCGAATCACTGGAAATATCTCGAGATATTTCCAGTGATTCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153786
VGLL2 MISSION shRNA Bacterial Glycerol Stock
vestigial like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-112s1c1
Sequence:CCGGCCACCAGAAACTAGCCTACTACTCGAGTAGTAGGCTAGTTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-82s1c1
Sequence:CCGGGCCTTATTTCGCAGCCGCCTACTCGAGTAGGCGGCTGCGAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-261s1c1
Sequence:CCGGCCGAAGCTGAGTACATCAACTCTCGAGAGTTGATGTACTCAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-277s1c1
Sequence:CCGGCAACTCCAGATGTGTCCTCTTCTCGAGAAGAGGACACATCTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153786.1-1316s1c1
Sequence:CCGGGACATAATACACACTGGATTTCTCGAGAAATCCAGTGTGTATTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153786
VGLL2 MISSION shRNA shRNA Plasmid DNA
vestigial like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-112s1c1
Sequence:CCGGCCACCAGAAACTAGCCTACTACTCGAGTAGTAGGCTAGTTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-82s1c1
Sequence:CCGGGCCTTATTTCGCAGCCGCCTACTCGAGTAGGCGGCTGCGAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-261s1c1
Sequence:CCGGCCGAAGCTGAGTACATCAACTCTCGAGAGTTGATGTACTCAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-277s1c1
Sequence:CCGGCAACTCCAGATGTGTCCTCTTCTCGAGAAGAGGACACATCTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153786.1-1316s1c1
Sequence:CCGGGACATAATACACACTGGATTTCTCGAGAAATCCAGTGTGTATTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153786
VGLL2 MISSION shRNA Lentiviral Transduction Particles
vestigial like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-112s1c1
Sequence:CCGGCCACCAGAAACTAGCCTACTACTCGAGTAGTAGGCTAGTTTCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-82s1c1
Sequence:CCGGGCCTTATTTCGCAGCCGCCTACTCGAGTAGGCGGCTGCGAAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-261s1c1
Sequence:CCGGCCGAAGCTGAGTACATCAACTCTCGAGAGTTGATGTACTCAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153786.1-277s1c1
Sequence:CCGGCAACTCCAGATGTGTCCTCTTCTCGAGAAGAGGACACATCTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153786.1-1316s1c1
Sequence:CCGGGACATAATACACACTGGATTTCTCGAGAAATCCAGTGTGTATTATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks