EMAIL THIS PAGE TO A FRIEND

VGLL3

vestigial like 3 (Drosophila)

Synonyms: VGL-3 VGL3
UniProtKB ID: A8MV65, D3DU37, Q504T7
Gene ID:
Mouse(73569) vestigial like 3 (Drosophila)
Rat(498038) vestigial like 3 (Drosophila)
chicken(418462) vestigial like 3 (Drosophila)
dog(607015) vestigial like 3 (Drosophila)
domestic cat(101084819) vestigial like 3 (Drosophila)
Horse(100069930) vestigial like 3 (Drosophila)
cow(781333) vestigial like 3 (Drosophila)
sheep(101101949) vestigial like 3 (Drosophila)
domestic guinea pig(100734531) vestigial like 3 (Drosophila)
naked mole-rat(101716428) vestigial like 3 (Drosophila)
313 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016206 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159241 MISSION® esiRNA esiRNA human VGLL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016206 Rosetta Predictions human pricing
XM_001064250 Rosetta Predictions rat pricing
XM_573239 Rosetta Predictions rat pricing
XM_001480406 Rosetta Predictions mouse pricing
XM_283372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059206 predicted 981
2 SASI_Hs01_00059207 predicted 1319
3 SASI_Hs02_00349055 predicted 1342
4 SASI_Hs01_00059208 predicted 1017
5 SASI_Hs01_00059210 predicted 485
6 SASI_Hs01_00059211 predicted 786
7 SASI_Hs01_00059212 predicted 776
8 SASI_Hs01_00059213 predicted 396
9 SASI_Hs01_00059215 predicted 642
10 SASI_Hs02_00349056 predicted 1343
11 SASI_Hs01_00059209 predicted 1258
12 SASI_Hs01_00059214 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309794 predicted 427
2 SASI_Rn02_00309795 predicted 545
3 SASI_Rn02_00309796 predicted 1299
4 SASI_Rn02_00309797 predicted 585
5 SASI_Rn02_00309798 predicted 1245
6 SASI_Rn02_00309799 predicted 1203
7 SASI_Rn02_00309800 predicted 1133
8 SASI_Rn02_00309801 predicted 1189
9 SASI_Rn02_00309802 predicted 302
10 SASI_Rn02_00309803 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400054 predicted 430
2 SASI_Rn02_00400055 predicted 543
3 SASI_Rn02_00400056 predicted 1294
4 SASI_Rn02_00400057 predicted 586
5 SASI_Rn02_00400058 predicted 1240
6 SASI_Rn02_00400059 predicted 1202
7 SASI_Rn02_00400060 predicted 1131
8 SASI_Rn02_00400061 predicted 1196
9 SASI_Rn02_00400062 predicted 309
10 SASI_Rn02_00400063 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00417370 predicted 983
2 SASI_Mm02_00417371 predicted 1098
3 SASI_Mm02_00417372 predicted 1062
4 SASI_Mm02_00417373 predicted 1107
5 SASI_Mm02_00417374 predicted 1006
6 SASI_Mm02_00417375 predicted 1104
7 SASI_Mm02_00417376 predicted 117
8 SASI_Mm02_00417377 predicted 414
9 SASI_Mm02_00417378 predicted 629
10 SASI_Mm02_00417379 predicted 18
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247833 predicted 980
2 SASI_Mm01_00247835 predicted 1100
3 SASI_Mm02_00425623 predicted 1067
4 SASI_Mm01_00247836 predicted 1105
5 SASI_Mm01_00247834 predicted 1006
6 SASI_Mm01_00247838 predicted 1101
7 SASI_Mm01_00247839 predicted 117
8 SASI_Mm01_00247840 predicted 418
9 SASI_Mm01_00247842 predicted 620
10 SASI_Mm02_00425624 predicted 1079
11 SASI_Mm01_00247837 predicted 1246
12 SASI_Mm01_00247841 predicted 1247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016206
VALIDATED
VGLL3 MISSION shRNA Bacterial Glycerol Stock
vestigial like 3 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016206.2-977s21c1
Sequence:CCGGGAGTCCTGGCCTTATCCTTTGCTCGAGCAAAGGATAAGGCCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016206.2-598s21c1
Sequence:CCGGTGCCGAGATGGAGTACCTTAACTCGAGTTAAGGTACTCCATCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016206.2-1257s21c1
Sequence:CCGGTTCATGGAACAGTAGACATAGCTCGAGCTATGTCTACTGTTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016206.2-1362s21c1
Sequence:CCGGGAGTTAAGTTGCAGCATAAATCTCGAGATTTATGCTGCAACTTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016206.2-1722s21c1
Sequence:CCGGGTAGCTCTATGTGCATCTATTCTCGAGAATAGATGCACATAGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016206.2-487s1c1
Sequence:CCGGGCAGAAGAAGTTAGCGGTATTCTCGAGAATACCGCTAACTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016206.2-3364s1c1
Sequence:CCGGCCCAAATACATGGAGCACAAACTCGAGTTTGTGCTCCATGTATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016206.2-9499s1c1
Sequence:CCGGGCATCTTATTTGACCTGCTTACTCGAGTAAGCAGGTCAAATAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016206.2-1255s1c1
Sequence:CCGGCTTTCATGGAACAGTAGACATCTCGAGATGTCTACTGTTCCATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016206.2-793s1c1
Sequence:CCGGGAATAGTTTCCCAACTTCCTTCTCGAGAAGGAAGTTGGGAAACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016206
VALIDATED
VGLL3 MISSION shRNA shRNA Plasmid DNA
vestigial like 3 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016206.2-977s21c1
Sequence:CCGGGAGTCCTGGCCTTATCCTTTGCTCGAGCAAAGGATAAGGCCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016206.2-598s21c1
Sequence:CCGGTGCCGAGATGGAGTACCTTAACTCGAGTTAAGGTACTCCATCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016206.2-1257s21c1
Sequence:CCGGTTCATGGAACAGTAGACATAGCTCGAGCTATGTCTACTGTTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016206.2-1362s21c1
Sequence:CCGGGAGTTAAGTTGCAGCATAAATCTCGAGATTTATGCTGCAACTTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016206.2-1722s21c1
Sequence:CCGGGTAGCTCTATGTGCATCTATTCTCGAGAATAGATGCACATAGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016206.2-487s1c1
Sequence:CCGGGCAGAAGAAGTTAGCGGTATTCTCGAGAATACCGCTAACTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016206.2-3364s1c1
Sequence:CCGGCCCAAATACATGGAGCACAAACTCGAGTTTGTGCTCCATGTATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016206.2-9499s1c1
Sequence:CCGGGCATCTTATTTGACCTGCTTACTCGAGTAAGCAGGTCAAATAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016206.2-1255s1c1
Sequence:CCGGCTTTCATGGAACAGTAGACATCTCGAGATGTCTACTGTTCCATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016206.2-793s1c1
Sequence:CCGGGAATAGTTTCCCAACTTCCTTCTCGAGAAGGAAGTTGGGAAACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016206
VALIDATED
VGLL3 MISSION shRNA Lentiviral Transduction Particles
vestigial like 3 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016206.2-977s21c1
Sequence:CCGGGAGTCCTGGCCTTATCCTTTGCTCGAGCAAAGGATAAGGCCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016206.2-598s21c1
Sequence:CCGGTGCCGAGATGGAGTACCTTAACTCGAGTTAAGGTACTCCATCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016206.2-1257s21c1
Sequence:CCGGTTCATGGAACAGTAGACATAGCTCGAGCTATGTCTACTGTTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016206.2-1362s21c1
Sequence:CCGGGAGTTAAGTTGCAGCATAAATCTCGAGATTTATGCTGCAACTTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016206.2-1722s21c1
Sequence:CCGGGTAGCTCTATGTGCATCTATTCTCGAGAATAGATGCACATAGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016206.2-487s1c1
Sequence:CCGGGCAGAAGAAGTTAGCGGTATTCTCGAGAATACCGCTAACTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016206.2-3364s1c1
Sequence:CCGGCCCAAATACATGGAGCACAAACTCGAGTTTGTGCTCCATGTATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016206.2-9499s1c1
Sequence:CCGGGCATCTTATTTGACCTGCTTACTCGAGTAAGCAGGTCAAATAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016206.2-1255s1c1
Sequence:CCGGCTTTCATGGAACAGTAGACATCTCGAGATGTCTACTGTTCCATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016206.2-793s1c1
Sequence:CCGGGAATAGTTTCCCAACTTCCTTCTCGAGAAGGAAGTTGGGAAACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028572
VGLL3 MISSION shRNA Bacterial Glycerol Stock
vestigial like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-120s21c1
Sequence:CCGGCCAGCAGAAGTTAGCGGTATACTCGAGTATACCGCTAACTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-240s21c1
Sequence:CCGGTGCCGAGATGGAGTACCTTAACTCGAGTTAAGGTACTCCATCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-614s21c1
Sequence:CCGGCGTCTGAGTCTTGGCACTATCCTCGAGGATAGTGCCAAGACTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028572.1-981s21c1
Sequence:CCGGCATGGTATCAGCAGATCATATCTCGAGATATGATCTGCTGATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-423s21c1
Sequence:CCGGTTCGAGCCAGCGGAGTAATTTCTCGAGAAATTACTCCGCTGGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028572
VGLL3 MISSION shRNA shRNA Plasmid DNA
vestigial like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-120s21c1
Sequence:CCGGCCAGCAGAAGTTAGCGGTATACTCGAGTATACCGCTAACTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-240s21c1
Sequence:CCGGTGCCGAGATGGAGTACCTTAACTCGAGTTAAGGTACTCCATCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-614s21c1
Sequence:CCGGCGTCTGAGTCTTGGCACTATCCTCGAGGATAGTGCCAAGACTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028572.1-981s21c1
Sequence:CCGGCATGGTATCAGCAGATCATATCTCGAGATATGATCTGCTGATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-423s21c1
Sequence:CCGGTTCGAGCCAGCGGAGTAATTTCTCGAGAAATTACTCCGCTGGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028572
VGLL3 MISSION shRNA Lentiviral Transduction Particles
vestigial like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-120s21c1
Sequence:CCGGCCAGCAGAAGTTAGCGGTATACTCGAGTATACCGCTAACTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-240s21c1
Sequence:CCGGTGCCGAGATGGAGTACCTTAACTCGAGTTAAGGTACTCCATCTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-614s21c1
Sequence:CCGGCGTCTGAGTCTTGGCACTATCCTCGAGGATAGTGCCAAGACTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028572.1-981s21c1
Sequence:CCGGCATGGTATCAGCAGATCATATCTCGAGATATGATCTGCTGATACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028572.1-423s21c1
Sequence:CCGGTTCGAGCCAGCGGAGTAATTTCTCGAGAAATTACTCCGCTGGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks