EMAIL THIS PAGE TO A FRIEND

VGLL4

vestigial like 4 (Drosophila)

Synonyms: VGL-4
UniProtKB ID: Q14135, B4DTS7, Q7L5V0, Q9BQ78
Gene ID:
Mouse(232334) vestigial like 4 (Drosophila)
Rat(297523) vestigial like 4 (Drosophila)
naked mole-rat(101714664) vestigial like 4 (Drosophila)
domestic guinea pig(100726160) vestigial like 4 (Drosophila)
cow(613904) vestigial like 4 (Drosophila)
sheep(101106039) vestigial like 4 (Drosophila)
chicken(415962) vestigial like 4 (Drosophila)
dog(607588) vestigial like 4 (Drosophila)
domestic cat(101093673) vestigial like 4 (Drosophila)
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014667 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128219 Rosetta Predictions human pricing
NM_001128220 Rosetta Predictions human pricing
NM_001128221 Rosetta Predictions human pricing
NM_014667 Rosetta Predictions human pricing
NM_001015004 Rosetta Predictions rat pricing
NM_177683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330916 predicted 1327
2 SASI_Hs02_00330917 predicted 1521
3 SASI_Hs02_00330918 predicted 1096
4 SASI_Hs02_00330919 predicted 1501
5 SASI_Hs02_00330920 predicted 1152
6 SASI_Hs02_00330921 predicted 1709
7 SASI_Hs02_00330922 predicted 608
8 SASI_Hs02_00330923 predicted 890
9 SASI_Hs02_00330924 predicted 1770
10 SASI_Hs02_00330925 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330926 predicted 725
2 SASI_Hs02_00330927 predicted 816
3 SASI_Hs02_00330928 predicted 921
4 SASI_Hs02_00330929 predicted 499
5 SASI_Hs02_00330930 predicted 1155
6 SASI_Hs02_00330931 predicted 896
7 SASI_Hs02_00330932 predicted 556
8 SASI_Hs02_00330933 predicted 1105
9 SASI_Hs02_00330934 predicted 296
10 SASI_Hs02_00330935 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330936 predicted 967
2 SASI_Hs02_00330937 predicted 1064
3 SASI_Hs02_00330938 predicted 1162
4 SASI_Hs02_00330939 predicted 745
5 SASI_Hs02_00330940 predicted 1402
6 SASI_Hs02_00330941 predicted 1136
7 SASI_Hs02_00330942 predicted 793
8 SASI_Hs02_00330943 predicted 1349
9 SASI_Hs02_00330944 predicted 537
10 SASI_Hs02_00330945 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162346 predicted 1272
2 SASI_Hs01_00162347 predicted 1465
3 SASI_Hs01_00162348 predicted 1041
4 SASI_Hs02_00346010 predicted 1436
5 SASI_Hs01_00162350 predicted 1092
6 SASI_Hs01_00162351 predicted 1651
7 SASI_Hs01_00162352 predicted 833
8 SASI_Hs01_00162353 predicted 1713
9 SASI_Hs01_00162354 predicted 571
10 SASI_Hs01_00162355 predicted 1718
11 SASI_Hs01_00162349 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201911 predicted 869
2 SASI_Rn02_00201912 predicted 1005
3 SASI_Rn02_00201913 predicted 862
4 SASI_Rn02_00201914 predicted 1013
5 SASI_Rn02_00201915 predicted 584
6 SASI_Rn02_00201916 predicted 1011
7 SASI_Rn02_00201917 predicted 807
8 SASI_Rn02_00201918 predicted 1018
9 SASI_Rn02_00201919 predicted 1002
10 SASI_Rn02_00201920 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053307 predicted 873
2 SASI_Mm01_00053308 predicted 816
3 SASI_Mm01_00053310 predicted 939
4 SASI_Mm02_00348012 predicted 1049
5 SASI_Mm01_00053311 predicted 869
6 SASI_Mm01_00053312 predicted 950
7 SASI_Mm01_00053314 predicted 760
8 SASI_Mm01_00053316 predicted 392
9 SASI_Mm02_00348013 predicted 802
10 SASI_Mm02_00348014 predicted 712
11 SASI_Mm01_00053309 predicted 1022
12 SASI_Mm01_00053313 predicted 1023
13 SASI_Mm01_00053315 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014667
VALIDATED
VGLL4 MISSION shRNA Bacterial Glycerol Stock
vestigial like 4 (Drosophila)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_014667.1-1562s1c1
Sequence:CCGGGCCTGACAACTTTATGTGTTACTCGAGTAACACATAAAGTTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014667.1-2865s1c1
Sequence:CCGGGCGTAAAGAATGTACAGAGAACTCGAGTTCTCTGTACATTCTTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014667.1-2133s1c1
Sequence:CCGGGCAGGCTGACATCATTTATTTCTCGAGAAATAAATGATGTCAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014667.1-1374s1c1
Sequence:CCGGGCTTTCTCAGTCACAAGCCATCTCGAGATGGCTTGTGACTGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014667.1-1298s1c1
Sequence:CCGGCCTTACTTCCTGCCTCAGTTACTCGAGTAACTGAGGCAGGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_014667.1-1306s1c1
Sequence:CCGGCCTGCCTCAGTTACCAAAGAACTCGAGTTCTTTGGTAACTGAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014667.1-342s1c1
Sequence:CCGGCAGCAAGAGGAAGTTCAGCATCTCGAGATGCTGAACTTCCTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014667.1-345s1c1
Sequence:CCGGCAAGAGGAAGTTCAGCATGGACTCGAGTCCATGCTGAACTTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014667.1-391s1c1
Sequence:CCGGGACAACGACCACGTCTCCAAACTCGAGTTTGGAGACGTGGTCGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014667.1-432s1c1
Sequence:CCGGCCATCTGAACAAGACTGCCAACTCGAGTTGGCAGTCTTGTTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014667.2-1892s21c1
Sequence:GTACCGGGAAGTCTCATACAGGTTATAGCTCGAGCTATAACCTGTATGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014667.2-1106s21c1
Sequence:CCGGACACGTGGCTCCAGATCAAAGCTCGAGCTTTGATCTGGAGCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014667.2-1008s21c1
Sequence:CCGGCAGGAGCCTGGGCAAGAATTACTCGAGTAATTCTTGCCCAGGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014667.2-617s21c1
Sequence:CCGGATCTGAACAAGACTGCCAATGCTCGAGCATTGGCAGTCTTGTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014667
VALIDATED
VGLL4 MISSION shRNA shRNA Plasmid DNA
vestigial like 4 (Drosophila)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_014667.1-1562s1c1
Sequence:CCGGGCCTGACAACTTTATGTGTTACTCGAGTAACACATAAAGTTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014667.1-2865s1c1
Sequence:CCGGGCGTAAAGAATGTACAGAGAACTCGAGTTCTCTGTACATTCTTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014667.1-2133s1c1
Sequence:CCGGGCAGGCTGACATCATTTATTTCTCGAGAAATAAATGATGTCAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014667.1-1374s1c1
Sequence:CCGGGCTTTCTCAGTCACAAGCCATCTCGAGATGGCTTGTGACTGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014667.1-1298s1c1
Sequence:CCGGCCTTACTTCCTGCCTCAGTTACTCGAGTAACTGAGGCAGGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_014667.1-1306s1c1
Sequence:CCGGCCTGCCTCAGTTACCAAAGAACTCGAGTTCTTTGGTAACTGAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014667.1-342s1c1
Sequence:CCGGCAGCAAGAGGAAGTTCAGCATCTCGAGATGCTGAACTTCCTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014667.1-345s1c1
Sequence:CCGGCAAGAGGAAGTTCAGCATGGACTCGAGTCCATGCTGAACTTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014667.1-391s1c1
Sequence:CCGGGACAACGACCACGTCTCCAAACTCGAGTTTGGAGACGTGGTCGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014667.1-432s1c1
Sequence:CCGGCCATCTGAACAAGACTGCCAACTCGAGTTGGCAGTCTTGTTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014667.2-1892s21c1
Sequence:GTACCGGGAAGTCTCATACAGGTTATAGCTCGAGCTATAACCTGTATGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014667.2-1106s21c1
Sequence:CCGGACACGTGGCTCCAGATCAAAGCTCGAGCTTTGATCTGGAGCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014667.2-1008s21c1
Sequence:CCGGCAGGAGCCTGGGCAAGAATTACTCGAGTAATTCTTGCCCAGGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014667.2-617s21c1
Sequence:CCGGATCTGAACAAGACTGCCAATGCTCGAGCATTGGCAGTCTTGTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014667
VALIDATED
VGLL4 MISSION shRNA Lentiviral Transduction Particles
vestigial like 4 (Drosophila)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_014667.1-1562s1c1
Sequence:CCGGGCCTGACAACTTTATGTGTTACTCGAGTAACACATAAAGTTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014667.1-2865s1c1
Sequence:CCGGGCGTAAAGAATGTACAGAGAACTCGAGTTCTCTGTACATTCTTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014667.1-2133s1c1
Sequence:CCGGGCAGGCTGACATCATTTATTTCTCGAGAAATAAATGATGTCAGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014667.1-1374s1c1
Sequence:CCGGGCTTTCTCAGTCACAAGCCATCTCGAGATGGCTTGTGACTGAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139816    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014667.1-1298s1c1
Sequence:CCGGCCTTACTTCCTGCCTCAGTTACTCGAGTAACTGAGGCAGGAAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_014667.1-1306s1c1
Sequence:CCGGCCTGCCTCAGTTACCAAAGAACTCGAGTTCTTTGGTAACTGAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014667.1-342s1c1
Sequence:CCGGCAGCAAGAGGAAGTTCAGCATCTCGAGATGCTGAACTTCCTCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014667.1-345s1c1
Sequence:CCGGCAAGAGGAAGTTCAGCATGGACTCGAGTCCATGCTGAACTTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014667.1-391s1c1
Sequence:CCGGGACAACGACCACGTCTCCAAACTCGAGTTTGGAGACGTGGTCGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014667.1-432s1c1
Sequence:CCGGCCATCTGAACAAGACTGCCAACTCGAGTTGGCAGTCTTGTTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014667.2-1892s21c1
Sequence:GTACCGGGAAGTCTCATACAGGTTATAGCTCGAGCTATAACCTGTATGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014667.2-1106s21c1
Sequence:CCGGACACGTGGCTCCAGATCAAAGCTCGAGCTTTGATCTGGAGCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014667.2-1008s21c1
Sequence:CCGGCAGGAGCCTGGGCAAGAATTACTCGAGTAATTCTTGCCCAGGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014667.2-617s21c1
Sequence:CCGGATCTGAACAAGACTGCCAATGCTCGAGCATTGGCAGTCTTGTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177683
VALIDATED
VGLL4 MISSION shRNA Bacterial Glycerol Stock
vestigial like 4 (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177683.2-421s1c1
Sequence:CCGGGTTCTGTGCTATGAAGGTGAACTCGAGTTCACCTTCATAGCACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177683.2-830s1c1
Sequence:CCGGCCTCTGTGATTACCTGTGCATCTCGAGATGCACAGGTAATCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177683.2-762s21c1
Sequence:CCGGGCCTCTTGCCCTGACTAAGAACTCGAGTTCTTAGTCAGGGCAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177683.2-397s21c1
Sequence:CCGGGACAAGATGAACAACAATATCCTCGAGGATATTGTTGTTCATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177683.2-397s1c1
Sequence:CCGGGACAAGATGAACAACAATATCCTCGAGGATATTGTTGTTCATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177683.2-1085s21c1
Sequence:CCGGACACATGGCTTCAGATCAAAGCTCGAGCTTTGATCTGAAGCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177683.2-1027s21c1
Sequence:CCGGCCTAACTCGGTGTCCATCACTCTCGAGAGTGATGGACACCGAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177683
VALIDATED
VGLL4 MISSION shRNA shRNA Plasmid DNA
vestigial like 4 (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177683.2-421s1c1
Sequence:CCGGGTTCTGTGCTATGAAGGTGAACTCGAGTTCACCTTCATAGCACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177683.2-830s1c1
Sequence:CCGGCCTCTGTGATTACCTGTGCATCTCGAGATGCACAGGTAATCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177683.2-762s21c1
Sequence:CCGGGCCTCTTGCCCTGACTAAGAACTCGAGTTCTTAGTCAGGGCAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177683.2-397s21c1
Sequence:CCGGGACAAGATGAACAACAATATCCTCGAGGATATTGTTGTTCATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177683.2-397s1c1
Sequence:CCGGGACAAGATGAACAACAATATCCTCGAGGATATTGTTGTTCATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177683.2-1085s21c1
Sequence:CCGGACACATGGCTTCAGATCAAAGCTCGAGCTTTGATCTGAAGCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177683.2-1027s21c1
Sequence:CCGGCCTAACTCGGTGTCCATCACTCTCGAGAGTGATGGACACCGAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177683
VALIDATED
VGLL4 MISSION shRNA Lentiviral Transduction Particles
vestigial like 4 (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175905    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177683.2-421s1c1
Sequence:CCGGGTTCTGTGCTATGAAGGTGAACTCGAGTTCACCTTCATAGCACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177683.2-830s1c1
Sequence:CCGGCCTCTGTGATTACCTGTGCATCTCGAGATGCACAGGTAATCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177683.2-762s21c1
Sequence:CCGGGCCTCTTGCCCTGACTAAGAACTCGAGTTCTTAGTCAGGGCAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177683.2-397s21c1
Sequence:CCGGGACAAGATGAACAACAATATCCTCGAGGATATTGTTGTTCATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177683.2-397s1c1
Sequence:CCGGGACAAGATGAACAACAATATCCTCGAGGATATTGTTGTTCATCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177683.2-1085s21c1
Sequence:CCGGACACATGGCTTCAGATCAAAGCTCGAGCTTTGATCTGAAGCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177683.2-1027s21c1
Sequence:CCGGCCTAACTCGGTGTCCATCACTCTCGAGAGTGATGGACACCGAGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks