EMAIL THIS PAGE TO A FRIEND

VHL

von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase

Synonyms: HRCA1 RCA1 VHL1 pVHL
UniProtKB ID: P40337, B2RE45, Q13599, Q6PDA9
Gene ID:
Human(7428) Summary: Von Hippel-Lindau syndrome (VHL) is a dominantly inherited familial cancer syndrome predisposing to a variety of malignant and benign tumors. A germline mutation of this gene is the basis of familial inheritance of VHL syndrome. The protein encoded by this gene is a component of the protein complex that includes elongin B, elongin C, and cullin-2, and possesses ubiquitin ligase E3 activity. This protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. RNA polymerase II subunit POLR2G/RPB7 is also reported to be a target of this protein. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(22346) von Hippel-Lindau tumor suppressor
Rat(24874) von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
fruit fly(53433) von Hippel-Lindau
domestic cat(101092590) von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
dog(494000) von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
chicken(416117) von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
Zebrafish(791202) von Hippel-Lindau tumor suppressor
cow(540957) von Hippel-Lindau tumor suppressor
sheep(101122897) von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
domestic guinea pig(100729230) von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
V0140 Anti-VHL (1-15) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
V0265 Anti-VHL (200-213) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4200285 Anti-VHL (C-terminal) antibody produced in rabbit ~1.5 mg/mL human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2501099 Anti-VHL antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, mouse, human, rat
ELISA, western blot pricing
SAB1406582 Anti-VHL antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4200434 Anti-VHL antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation, western blot pricing
SAB4503075 Anti-VHL antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
HPA031631 Anti-VHL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA031632 Anti-VHL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0007428M1 Monoclonal Anti-VHL antibody produced in mouse clone 1G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1775 Human VHL ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000551 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000551 Rosetta Predictions human pricing
NM_198156 Rosetta Predictions human pricing
NM_052801 Rosetta Predictions rat pricing
NM_009507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302782 predicted 1002
2 SASI_Hs01_00235782 predicted 951
3 SASI_Hs02_00302783 predicted 898
4 SASI_Hs02_00302784 predicted 311
5 SASI_Hs02_00302785 predicted 899
6 SASI_Hs02_00302786 predicted 901
7 SASI_Hs02_00302787 predicted 1005
8 SASI_Hs02_00302788 predicted 1003
9 SASI_Hs02_00302789 predicted 316
10 SASI_Hs02_00302790 predicted 251
11 SASI_Hs01_00235777 predicted 1060
12 SASI_Hs01_00235778 predicted 1118
13 SASI_Hs01_00235779 predicted 1347
14 SASI_Hs01_00235780 predicted 1162
15 SASI_Hs01_00235781 predicted 1198
16 SASI_Hs01_00235783 predicted 1237
17 SASI_Hs01_00235784 predicted 1219
18 SASI_Hs01_00235785 predicted 1132
19 SASI_Hs01_00235786 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371694 predicted 933
2 SASI_Hs02_00371695 predicted 990
3 SASI_Hs02_00371696 predicted 1216
4 SASI_Hs02_00371697 predicted 1039
5 SASI_Hs01_00048181 predicted 821
6 SASI_Hs02_00371698 predicted 1109
7 SASI_Hs02_00371699 predicted 1092
8 SASI_Hs02_00371700 predicted 997
9 SASI_Hs01_00048184 predicted 774
10 SASI_Hs01_00048185 predicted 780
11 SASI_Hs01_00048180 predicted 881
12 SASI_Hs01_00048182 predicted 783
13 SASI_Hs01_00048183 predicted 319
14 SASI_Hs01_00048186 predicted 888
15 SASI_Hs01_00048187 predicted 886
16 SASI_Hs01_00048188 predicted 315
17 SASI_Hs01_00048189 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086012 predicted 934
2 SASI_Rn01_00086014 predicted 388
3 SASI_Rn01_00086015 predicted 1041
4 SASI_Rn01_00086016 predicted 861
5 SASI_Rn01_00086017 predicted 759
6 SASI_Rn02_00265591 predicted 917
7 SASI_Rn01_00086018 predicted 1126
8 SASI_Rn01_00086020 predicted 718
9 SASI_Rn02_00265592 predicted 1033
10 SASI_Rn01_00086021 predicted 901
11 SASI_Rn01_00086013 predicted 270
12 SASI_Rn01_00086019 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082870 predicted 755
2 SASI_Mm02_00316286 predicted 936
3 SASI_Mm02_00316287 predicted 425
4 SASI_Mm01_00082874 predicted 666
5 SASI_Mm02_00316288 predicted 395
6 SASI_Mm02_00316289 predicted 964
7 SASI_Mm01_00082876 predicted 552
8 SASI_Mm02_00316290 predicted 548
9 SASI_Mm01_00082878 predicted 267
10 SASI_Mm02_00316291 predicted 641
11 SASI_Mm01_00082871 predicted 742
12 SASI_Mm01_00082872 predicted 972
13 SASI_Mm01_00082873 predicted 922
14 SASI_Mm01_00082875 predicted 279
15 SASI_Mm01_00082877 predicted 231
16 SASI_Mm01_00082879 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009507
VALIDATED
VHL MISSION shRNA Bacterial Glycerol Stock
von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-391s21c1
Sequence:CCGGCATGATGGACTTCTGGTTAACCTCGAGGTTAACCAGAAGTCCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-302s21c1
Sequence:CCGGCTCAGCCCTACCCGATCTTACCTCGAGGTAAGATCGGGTAGGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009507.3-701s21c1
Sequence:CCGGAGCCTTGATGGTCCGAGATTGCTCGAGCAATCTCGGACCATCAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-577s21c1
Sequence:CCGGGATTTGGAGGACTACCCAAGTCTCGAGACTTGGGTAGTCCTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-440s21c1
Sequence:CCGGATGTCGATGGACAGCCTATTTCTCGAGAAATAGGCTGTCCATCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-610s21c1
Sequence:CCGGATACAGCGACTGAGCCAAGAGCTCGAGCTCTTGGCTCAGTCGCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-428s21c1
Sequence:CCGGTGCCATCCCTCAATGTCGATGCTCGAGCATCGACATTGAGGGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-467s21c1
Sequence:CCGGACATCACATTGCCAGTGTATACTCGAGTATACACTGGCAATGTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-593s21c1
Sequence:CCGGCAAGTGTGCGGAAGGACATACCTCGAGGTATGTCCTTCCGCACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009507.2-553s1c1
Sequence:CCGGGACATCGTCAGGTCACTCTATCTCGAGATAGAGTGACCTGACGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009507.2-406s1c1
Sequence:CCGGGTTAACCAAACGGAGCTGTTTCTCGAGAAACAGCTCCGTTTGGTTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009507.2-537s1c1
Sequence:CCGGGAACTACAGGAGACTGGACATCTCGAGATGTCCAGTCTCCTGTAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009507.2-232s1c1
Sequence:CCGGTCTCAGGTCATCTTCTGCAATCTCGAGATTGCAGAAGATGACCTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009507.2-816s1c1
Sequence:CCGGCCCTGGGCTTTGTAGTGTTTACTCGAGTAAACACTACAAAGCCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009507
VALIDATED
VHL MISSION shRNA shRNA Plasmid DNA
von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-391s21c1
Sequence:CCGGCATGATGGACTTCTGGTTAACCTCGAGGTTAACCAGAAGTCCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-302s21c1
Sequence:CCGGCTCAGCCCTACCCGATCTTACCTCGAGGTAAGATCGGGTAGGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009507.3-701s21c1
Sequence:CCGGAGCCTTGATGGTCCGAGATTGCTCGAGCAATCTCGGACCATCAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-577s21c1
Sequence:CCGGGATTTGGAGGACTACCCAAGTCTCGAGACTTGGGTAGTCCTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-440s21c1
Sequence:CCGGATGTCGATGGACAGCCTATTTCTCGAGAAATAGGCTGTCCATCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-610s21c1
Sequence:CCGGATACAGCGACTGAGCCAAGAGCTCGAGCTCTTGGCTCAGTCGCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-428s21c1
Sequence:CCGGTGCCATCCCTCAATGTCGATGCTCGAGCATCGACATTGAGGGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-467s21c1
Sequence:CCGGACATCACATTGCCAGTGTATACTCGAGTATACACTGGCAATGTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-593s21c1
Sequence:CCGGCAAGTGTGCGGAAGGACATACCTCGAGGTATGTCCTTCCGCACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009507.2-553s1c1
Sequence:CCGGGACATCGTCAGGTCACTCTATCTCGAGATAGAGTGACCTGACGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009507.2-406s1c1
Sequence:CCGGGTTAACCAAACGGAGCTGTTTCTCGAGAAACAGCTCCGTTTGGTTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009507.2-537s1c1
Sequence:CCGGGAACTACAGGAGACTGGACATCTCGAGATGTCCAGTCTCCTGTAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009507.2-232s1c1
Sequence:CCGGTCTCAGGTCATCTTCTGCAATCTCGAGATTGCAGAAGATGACCTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009507.2-816s1c1
Sequence:CCGGCCCTGGGCTTTGTAGTGTTTACTCGAGTAAACACTACAAAGCCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009507
VALIDATED
VHL MISSION shRNA Lentiviral Transduction Particles
von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-391s21c1
Sequence:CCGGCATGATGGACTTCTGGTTAACCTCGAGGTTAACCAGAAGTCCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-302s21c1
Sequence:CCGGCTCAGCCCTACCCGATCTTACCTCGAGGTAAGATCGGGTAGGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009507.3-701s21c1
Sequence:CCGGAGCCTTGATGGTCCGAGATTGCTCGAGCAATCTCGGACCATCAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-577s21c1
Sequence:CCGGGATTTGGAGGACTACCCAAGTCTCGAGACTTGGGTAGTCCTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-440s21c1
Sequence:CCGGATGTCGATGGACAGCCTATTTCTCGAGAAATAGGCTGTCCATCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-610s21c1
Sequence:CCGGATACAGCGACTGAGCCAAGAGCTCGAGCTCTTGGCTCAGTCGCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-428s21c1
Sequence:CCGGTGCCATCCCTCAATGTCGATGCTCGAGCATCGACATTGAGGGATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-467s21c1
Sequence:CCGGACATCACATTGCCAGTGTATACTCGAGTATACACTGGCAATGTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009507.3-593s21c1
Sequence:CCGGCAAGTGTGCGGAAGGACATACCTCGAGGTATGTCCTTCCGCACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009507.2-553s1c1
Sequence:CCGGGACATCGTCAGGTCACTCTATCTCGAGATAGAGTGACCTGACGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009507.2-406s1c1
Sequence:CCGGGTTAACCAAACGGAGCTGTTTCTCGAGAAACAGCTCCGTTTGGTTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009507.2-537s1c1
Sequence:CCGGGAACTACAGGAGACTGGACATCTCGAGATGTCCAGTCTCCTGTAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009507.2-232s1c1
Sequence:CCGGTCTCAGGTCATCTTCTGCAATCTCGAGATTGCAGAAGATGACCTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009507.2-816s1c1
Sequence:CCGGCCCTGGGCTTTGTAGTGTTTACTCGAGTAAACACTACAAAGCCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000551
VALIDATED
VHL MISSION shRNA Bacterial Glycerol Stock
von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000551.2-772s21c1
Sequence:CCGGGATCTGGAAGACCACCCAAATCTCGAGATTTGGGTGGTCTTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000551.2-625s21c1
Sequence:CCGGCCATCTCTCAATGTTGACGGACTCGAGTCCGTCAACATTGAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000551.2-1588s21c1
Sequence:CCGGTAGGATTGACATTCTACAGTTCTCGAGAACTGTAGAATGTCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000551.2-663s21c1
Sequence:CCGGTATCACACTGCCAGTGTATACCTCGAGGTATACACTGGCAGTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000551.2-2372s1c1
Sequence:CCGGCCCTATTAGATACACTTCTTACTCGAGTAAGAAGTGTATCTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000551.2-772s1c1
Sequence:CCGGGATCTGGAAGACCACCCAAATCTCGAGATTTGGGTGGTCTTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000551.2-716s1c1
Sequence:CCGGGCCTAGTCAAGCCTGAGAATTCTCGAGAATTCTCAGGCTTGACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000551.2-625s1c1
Sequence:CCGGCCATCTCTCAATGTTGACGGACTCGAGTCCGTCAACATTGAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000551.x-522s1c1
Sequence:CCGGTATCACACTGCCAGTGTATACCTCGAGGTATACACTGGCAGTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000551.x-1447s1c1
Sequence:CCGGTAGGATTGACATTCTACAGTTCTCGAGAACTGTAGAATGTCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000551
VALIDATED
VHL MISSION shRNA shRNA Plasmid DNA
von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000551.2-772s21c1
Sequence:CCGGGATCTGGAAGACCACCCAAATCTCGAGATTTGGGTGGTCTTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000551.2-625s21c1
Sequence:CCGGCCATCTCTCAATGTTGACGGACTCGAGTCCGTCAACATTGAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000551.2-1588s21c1
Sequence:CCGGTAGGATTGACATTCTACAGTTCTCGAGAACTGTAGAATGTCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000551.2-663s21c1
Sequence:CCGGTATCACACTGCCAGTGTATACCTCGAGGTATACACTGGCAGTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000551.2-2372s1c1
Sequence:CCGGCCCTATTAGATACACTTCTTACTCGAGTAAGAAGTGTATCTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000551.2-772s1c1
Sequence:CCGGGATCTGGAAGACCACCCAAATCTCGAGATTTGGGTGGTCTTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000551.2-716s1c1
Sequence:CCGGGCCTAGTCAAGCCTGAGAATTCTCGAGAATTCTCAGGCTTGACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000551.2-625s1c1
Sequence:CCGGCCATCTCTCAATGTTGACGGACTCGAGTCCGTCAACATTGAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000551.x-522s1c1
Sequence:CCGGTATCACACTGCCAGTGTATACCTCGAGGTATACACTGGCAGTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000551.x-1447s1c1
Sequence:CCGGTAGGATTGACATTCTACAGTTCTCGAGAACTGTAGAATGTCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000551
VALIDATED
VHL MISSION shRNA Lentiviral Transduction Particles
von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000551.2-772s21c1
Sequence:CCGGGATCTGGAAGACCACCCAAATCTCGAGATTTGGGTGGTCTTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000551.2-625s21c1
Sequence:CCGGCCATCTCTCAATGTTGACGGACTCGAGTCCGTCAACATTGAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000551.2-1588s21c1
Sequence:CCGGTAGGATTGACATTCTACAGTTCTCGAGAACTGTAGAATGTCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000551.2-663s21c1
Sequence:CCGGTATCACACTGCCAGTGTATACCTCGAGGTATACACTGGCAGTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000551.2-2372s1c1
Sequence:CCGGCCCTATTAGATACACTTCTTACTCGAGTAAGAAGTGTATCTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_000551.2-772s1c1
Sequence:CCGGGATCTGGAAGACCACCCAAATCTCGAGATTTGGGTGGTCTTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000551.2-716s1c1
Sequence:CCGGGCCTAGTCAAGCCTGAGAATTCTCGAGAATTCTCAGGCTTGACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000551.2-625s1c1
Sequence:CCGGCCATCTCTCAATGTTGACGGACTCGAGTCCGTCAACATTGAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000551.x-522s1c1
Sequence:CCGGTATCACACTGCCAGTGTATACCTCGAGGTATACACTGGCAGTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000551.x-1447s1c1
Sequence:CCGGTAGGATTGACATTCTACAGTTCTCGAGAACTGTAGAATGTCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks