EMAIL THIS PAGE TO A FRIEND

VHLL

von Hippel-Lindau tumor suppressor-like

Synonyms: VHLP VLP
UniProtKB ID: Q6RSH7, A1L4M4
Gene ID:
Human(391104) Summary: Von Hippel-Lindau (VHL) tumor suppressor protein is a component of an E3 ubiquitin ligase complex that selectively ubiquitinates the alpha subunit of the hypoxia-inducible factor (HIF) transcription factor for proteasome-mediated degradation. Inactivation of VHL causes VHL disease and sporadic kidney cancer. This gene encodes a VHL homolog that lacks one of two key domains necessary for VHL function. This gene may contribute to the regulation of oxygen homeostasis and neovascularization during placenta development. This gene is intronless, and can also be interpreted as a retrotransposed pseudogene of the VHL locus located on chromosome 3. However, the protein is represented in this RefSeq due to evidence in PMID:14757845 that strongly suggests it is translated. The same publication also indicates that this protein binds HIF alpha but fails to recruit the E3 ubiquitin ligase complex, and it therefore functions as a dominant-negative VHL protein and a protector of HIF alpha. [provided by RefSeq, Jan 2010]
Rat(686711) von Hippel-Lindau tumor suppressor-like
Zebrafish(795635) von Hippel-Lindau tumor suppressor like
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412964 Anti-VHLL antibody produced in mouse purified immunoglobulin, 0.5 mg/mL human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004319 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004319 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004319 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004319 Rosetta Predictions human pricing
XM_001075358 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165424 predicted 235
2 SASI_Hs01_00165425 predicted 412
3 SASI_Hs01_00165426 predicted 425
4 SASI_Hs01_00165427 predicted 269
5 SASI_Hs01_00165428 predicted 411
6 SASI_Hs01_00165429 predicted 273
7 SASI_Hs01_00165430 predicted 318
8 SASI_Hs01_00165431 predicted 260
9 SASI_Hs01_00165432 predicted 289
10 SASI_Hs01_00165433 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349458 predicted 334
2 SASI_Rn02_00349459 predicted 281
3 SASI_Rn02_00349460 predicted 269
4 SASI_Rn02_00349461 predicted 284
5 SASI_Rn02_00349462 predicted 187
6 SASI_Rn02_00349463 predicted 98
7 SASI_Rn02_00349464 predicted 291
8 SASI_Rn02_00349465 predicted 216
9 SASI_Rn02_00349466 predicted 325
10 SASI_Rn02_00349467 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004319
VHLL MISSION shRNA Bacterial Glycerol Stock
von Hippel-Lindau tumor suppressor-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-420s1c1
Sequence:CCGGGCAAGGACACATGATAAGCTTCTCGAGAAGCTTATCATGTGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-320s1c1
Sequence:CCGGGCTCAACTACTATGGCAAGCTCTCGAGAGCTTGCCATAGTAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-468s1c1
Sequence:CCGGCCATCTTCCAATGTTAATGGACTCGAGTCCATTAACATTGGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-427s1c1
Sequence:CCGGCACATGATAAGCTTCTGGTTACTCGAGTAACCAGAAGCTTATCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-270s1c1
Sequence:CCGGTCCCGGATCATCATCTGCAATCTCGAGATTGCAGATGATGATCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004319
VHLL MISSION shRNA shRNA Plasmid DNA
von Hippel-Lindau tumor suppressor-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-420s1c1
Sequence:CCGGGCAAGGACACATGATAAGCTTCTCGAGAAGCTTATCATGTGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-320s1c1
Sequence:CCGGGCTCAACTACTATGGCAAGCTCTCGAGAGCTTGCCATAGTAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-468s1c1
Sequence:CCGGCCATCTTCCAATGTTAATGGACTCGAGTCCATTAACATTGGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-427s1c1
Sequence:CCGGCACATGATAAGCTTCTGGTTACTCGAGTAACCAGAAGCTTATCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-270s1c1
Sequence:CCGGTCCCGGATCATCATCTGCAATCTCGAGATTGCAGATGATGATCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004319
VHLL MISSION shRNA Lentiviral Transduction Particles
von Hippel-Lindau tumor suppressor-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-420s1c1
Sequence:CCGGGCAAGGACACATGATAAGCTTCTCGAGAAGCTTATCATGTGTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-320s1c1
Sequence:CCGGGCTCAACTACTATGGCAAGCTCTCGAGAGCTTGCCATAGTAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-468s1c1
Sequence:CCGGCCATCTTCCAATGTTAATGGACTCGAGTCCATTAACATTGGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-427s1c1
Sequence:CCGGCACATGATAAGCTTCTGGTTACTCGAGTAACCAGAAGCTTATCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004319.1-270s1c1
Sequence:CCGGTCCCGGATCATCATCTGCAATCTCGAGATTGCAGATGATGATCCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks