EMAIL THIS PAGE TO A FRIEND

VIL1

villin 1

Synonyms: D2S1471 VIL
UniProtKB ID: P09327, B2R9A7
Gene ID:
Human(7429) Summary: This gene encodes a member of a family of calcium-regulated actin-binding proteins. This protein represents a dominant part of the brush border cytoskeleton which functions in the capping, severing, and bundling of actin filaments. Two mRNAs of 2.7 kb and 3.5 kb have been observed; they result from utilization of alternate poly-adenylation signals present in the terminal exon. [provided by RefSeq, Jul 2008]
Mouse(22349) villin 1
Rat(316521) villin 1
Horse(100058581) villin 1
chicken(396423) villin 1
dog(488522) villin 1
cow(281573) villin 1
sheep(101110570) villin 1
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406583 Anti-VIL1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA006884 Anti-VIL1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA006885 Anti-VIL1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1411391 Anti-VIL1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB5500190 Anti-Villin antibody, Rabbit monoclonal clone SP145, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB4200532 Anti-Villin-1 (C-terminal region) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4200533 Anti-Villin-1 (internal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306702 ANTI-VILLIN-1(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
WH0007429M2 Monoclonal Anti-VIL1 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404525 Monoclonal Anti-VIL1 antibody produced in mouse clone 2F10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007127 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007127 Rosetta Predictions human pricing
NM_001108224 Rosetta Predictions rat pricing
NM_009509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183532 predicted 1623
2 SASI_Hs02_00343014 predicted 481
3 SASI_Hs01_00183533 predicted 774
4 SASI_Hs01_00183535 predicted 1642
5 SASI_Hs01_00183536 predicted 1420
6 SASI_Hs01_00183537 predicted 1400
7 SASI_Hs01_00183538 predicted 2271
8 SASI_Hs01_00183539 predicted 897
9 SASI_Hs01_00183540 predicted 1930
10 SASI_Hs01_00183541 predicted 2178
11 SASI_Hs01_00183534 predicted 2243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236544 predicted 2403
2 SASI_Rn02_00236545 predicted 1812
3 SASI_Rn02_00236546 predicted 882
4 SASI_Rn02_00236547 predicted 2339
5 SASI_Rn02_00236548 predicted 306
6 SASI_Rn02_00236549 predicted 981
7 SASI_Rn02_00236550 predicted 1763
8 SASI_Rn02_00236551 predicted 2029
9 SASI_Rn02_00236552 predicted 2400
10 SASI_Rn02_00236553 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316296 predicted 2062
2 SASI_Mm01_00063136 predicted 762
3 SASI_Mm01_00063137 predicted 1372
4 SASI_Mm01_00063138 predicted 2217
5 SASI_Mm01_00063139 predicted 889
6 SASI_Mm01_00063140 predicted 514
7 SASI_Mm01_00063141 predicted 810
8 SASI_Mm01_00063142 predicted 2087
9 SASI_Mm01_00063143 predicted 1637
10 SASI_Mm01_00063144 predicted 1963
11 SASI_Mm01_00063135 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007127
VIL1 MISSION shRNA Bacterial Glycerol Stock
villin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007127.1-2542s1c1
Sequence:CCGGCCCTGATTGTAGGGTCTCATTCTCGAGAATGAGACCCTACAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-964s1c1
Sequence:CCGGCATGCGCTGAACTTCATCAAACTCGAGTTTGATGAAGTTCAGCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-775s1c1
Sequence:CCGGGCTGCACTCAAACTGTACCATCTCGAGATGGTACAGTTTGAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-1379s1c1
Sequence:CCGGGCCAAGATGAAATTACAGCATCTCGAGATGCTGTAATTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-2266s1c1
Sequence:CCGGCCCAAAGTGGACGTGTTCAATCTCGAGATTGAACACGTCCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007127.2-1684s21c1
Sequence:CCGGTCAATTCCAATGATGTCTTTGCTCGAGCAAAGACATCATTGGAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007127.2-1715s21c1
Sequence:CCGGCCAGTCTTGCTGCTATCTATGCTCGAGCATAGATAGCAGCAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007127.2-2088s21c1
Sequence:CCGGGCAACCACTGCACAGGAATACCTCGAGGTATTCCTGTGCAGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007127
VIL1 MISSION shRNA shRNA Plasmid DNA
villin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007127.1-2542s1c1
Sequence:CCGGCCCTGATTGTAGGGTCTCATTCTCGAGAATGAGACCCTACAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-964s1c1
Sequence:CCGGCATGCGCTGAACTTCATCAAACTCGAGTTTGATGAAGTTCAGCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-775s1c1
Sequence:CCGGGCTGCACTCAAACTGTACCATCTCGAGATGGTACAGTTTGAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-1379s1c1
Sequence:CCGGGCCAAGATGAAATTACAGCATCTCGAGATGCTGTAATTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-2266s1c1
Sequence:CCGGCCCAAAGTGGACGTGTTCAATCTCGAGATTGAACACGTCCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007127.2-1684s21c1
Sequence:CCGGTCAATTCCAATGATGTCTTTGCTCGAGCAAAGACATCATTGGAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007127.2-1715s21c1
Sequence:CCGGCCAGTCTTGCTGCTATCTATGCTCGAGCATAGATAGCAGCAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007127.2-2088s21c1
Sequence:CCGGGCAACCACTGCACAGGAATACCTCGAGGTATTCCTGTGCAGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007127
VIL1 MISSION shRNA Lentiviral Transduction Particles
villin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007127.1-2542s1c1
Sequence:CCGGCCCTGATTGTAGGGTCTCATTCTCGAGAATGAGACCCTACAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-964s1c1
Sequence:CCGGCATGCGCTGAACTTCATCAAACTCGAGTTTGATGAAGTTCAGCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-775s1c1
Sequence:CCGGGCTGCACTCAAACTGTACCATCTCGAGATGGTACAGTTTGAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-1379s1c1
Sequence:CCGGGCCAAGATGAAATTACAGCATCTCGAGATGCTGTAATTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007127.1-2266s1c1
Sequence:CCGGCCCAAAGTGGACGTGTTCAATCTCGAGATTGAACACGTCCACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007127.2-1684s21c1
Sequence:CCGGTCAATTCCAATGATGTCTTTGCTCGAGCAAAGACATCATTGGAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007127.2-1715s21c1
Sequence:CCGGCCAGTCTTGCTGCTATCTATGCTCGAGCATAGATAGCAGCAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007127.2-2088s21c1
Sequence:CCGGGCAACCACTGCACAGGAATACCTCGAGGTATTCCTGTGCAGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009509
VALIDATED
VIL1 MISSION shRNA Bacterial Glycerol Stock
villin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-2652s1c1
Sequence:CCGGCCACAGTGTGACAATTCCTTTCTCGAGAAAGGAATTGTCACACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-891s1c1
Sequence:CCGGGCTCAAGCATGAGGACTGTTACTCGAGTAACAGTCCTCATGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-2208s1c1
Sequence:CCGGGTGGAGTAACACCAAATCCTACTCGAGTAGGATTTGGTGTTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-1789s1c1
Sequence:CCGGCGGACGGAGAAACAAGTGGTACTCGAGTACCACTTGTTTCTCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-105s1c1
Sequence:CCGGCGGGATACAGATATGGAGGATCTCGAGATCCTCCATATCTGTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-901s21c1
Sequence:CCGGGCTCAAGCATGAGGACTGTTACTCGAGTAACAGTCCTCATGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009509.2-2662s21c1
Sequence:CCGGCCACAGTGTGACAATTCCTTTCTCGAGAAAGGAATTGTCACACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-115s21c1
Sequence:CCGGCGGGATACAGATATGGAGGATCTCGAGATCCTCCATATCTGTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-2218s21c1
Sequence:CCGGGTGGAGTAACACCAAATCCTACTCGAGTAGGATTTGGTGTTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-1799s21c1
Sequence:CCGGCGGACGGAGAAACAAGTGGTACTCGAGTACCACTTGTTTCTCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009509
VALIDATED
VIL1 MISSION shRNA shRNA Plasmid DNA
villin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-2652s1c1
Sequence:CCGGCCACAGTGTGACAATTCCTTTCTCGAGAAAGGAATTGTCACACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-891s1c1
Sequence:CCGGGCTCAAGCATGAGGACTGTTACTCGAGTAACAGTCCTCATGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-2208s1c1
Sequence:CCGGGTGGAGTAACACCAAATCCTACTCGAGTAGGATTTGGTGTTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-1789s1c1
Sequence:CCGGCGGACGGAGAAACAAGTGGTACTCGAGTACCACTTGTTTCTCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-105s1c1
Sequence:CCGGCGGGATACAGATATGGAGGATCTCGAGATCCTCCATATCTGTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-901s21c1
Sequence:CCGGGCTCAAGCATGAGGACTGTTACTCGAGTAACAGTCCTCATGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009509.2-2662s21c1
Sequence:CCGGCCACAGTGTGACAATTCCTTTCTCGAGAAAGGAATTGTCACACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-115s21c1
Sequence:CCGGCGGGATACAGATATGGAGGATCTCGAGATCCTCCATATCTGTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-2218s21c1
Sequence:CCGGGTGGAGTAACACCAAATCCTACTCGAGTAGGATTTGGTGTTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-1799s21c1
Sequence:CCGGCGGACGGAGAAACAAGTGGTACTCGAGTACCACTTGTTTCTCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009509
VALIDATED
VIL1 MISSION shRNA Lentiviral Transduction Particles
villin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-2652s1c1
Sequence:CCGGCCACAGTGTGACAATTCCTTTCTCGAGAAAGGAATTGTCACACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-891s1c1
Sequence:CCGGGCTCAAGCATGAGGACTGTTACTCGAGTAACAGTCCTCATGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-2208s1c1
Sequence:CCGGGTGGAGTAACACCAAATCCTACTCGAGTAGGATTTGGTGTTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-1789s1c1
Sequence:CCGGCGGACGGAGAAACAAGTGGTACTCGAGTACCACTTGTTTCTCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009509.1-105s1c1
Sequence:CCGGCGGGATACAGATATGGAGGATCTCGAGATCCTCCATATCTGTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-901s21c1
Sequence:CCGGGCTCAAGCATGAGGACTGTTACTCGAGTAACAGTCCTCATGCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009509.2-2662s21c1
Sequence:CCGGCCACAGTGTGACAATTCCTTTCTCGAGAAAGGAATTGTCACACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-115s21c1
Sequence:CCGGCGGGATACAGATATGGAGGATCTCGAGATCCTCCATATCTGTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-2218s21c1
Sequence:CCGGGTGGAGTAACACCAAATCCTACTCGAGTAGGATTTGGTGTTACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009509.2-1799s21c1
Sequence:CCGGCGGACGGAGAAACAAGTGGTACTCGAGTACCACTTGTTTCTCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks