EMAIL THIS PAGE TO A FRIEND

VILL

villin-like

UniProtKB ID: O15195, A8MZP1, Q9BT80, Q9BWH7
Gene ID:
Human(50853) Summary: The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]
Mouse(22351) villin-like
Rat(301057) villin-like
cow(781105) villin-like
sheep(101114982) villin-like
chicken(420415) villin-like
Horse(100050148) villin-like
dog(485585) villin-like
Gene Class: Cytoskeleton
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015873 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003601 MISSION® esiRNA esiRNA targeting mouse Vill (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015873 Rosetta Predictions human pricing
XM_001077346 Rosetta Predictions rat pricing
XM_217296 Rosetta Predictions rat pricing
NM_011700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348457 predicted 2001
2 SASI_Hs01_00038945 predicted 1455
3 SASI_Hs01_00038946 predicted 2302
4 SASI_Hs01_00038947 predicted 1993
5 SASI_Hs01_00038948 predicted 397
6 SASI_Hs01_00038949 predicted 1466
7 SASI_Hs01_00038950 predicted 2264
8 SASI_Hs01_00038951 predicted 1739
9 SASI_Hs01_00038953 predicted 1878
10 SASI_Hs01_00038954 predicted 1120
11 SASI_Hs01_00038952 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356712 predicted 572
2 SASI_Rn02_00356713 predicted 1942
3 SASI_Rn02_00356714 predicted 1764
4 SASI_Rn02_00356715 predicted 2070
5 SASI_Rn02_00356716 predicted 1767
6 SASI_Rn02_00356717 predicted 2126
7 SASI_Rn02_00356718 predicted 613
8 SASI_Rn02_00356719 predicted 2153
9 SASI_Rn02_00356720 predicted 1056
10 SASI_Rn02_00356721 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377110 predicted 716
2 SASI_Rn02_00377111 predicted 2089
3 SASI_Rn02_00377112 predicted 1902
4 SASI_Rn02_00377113 predicted 2209
5 SASI_Rn02_00377114 predicted 1911
6 SASI_Rn02_00377115 predicted 2271
7 SASI_Rn02_00377116 predicted 757
8 SASI_Rn02_00377117 predicted 2294
9 SASI_Rn02_00377118 predicted 1197
10 SASI_Rn02_00377119 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048243 predicted 1938
2 SASI_Mm01_00048244 predicted 1950
3 SASI_Mm01_00048246 predicted 1212
4 SASI_Mm01_00048247 predicted 995
5 SASI_Mm02_00321258 predicted 740
6 SASI_Mm01_00048248 predicted 1539
7 SASI_Mm01_00048249 predicted 1110
8 SASI_Mm01_00048250 predicted 425
9 SASI_Mm01_00048251 predicted 2146
10 SASI_Mm01_00048252 predicted 1652
11 SASI_Mm01_00048245 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011700
VALIDATED
VILL MISSION shRNA Bacterial Glycerol Stock
villin-like
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-2174s21c1
Sequence:CCGGGCAGTGACTCAATGGTCAATGCTCGAGCATTGACCATTGAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011700.2-2399s21c1
Sequence:CCGGGTGCCACATACCCTGAAATTCCTCGAGGAATTTCAGGGTATGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-148s21c1
Sequence:CCGGGAAAGGGCTCATGGGAATTTCCTCGAGGAAATTCCCATGAGCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-709s21c1
Sequence:CCGGACCAACCTTCTGCGCATCATGCTCGAGCATGATGCGCAGAAGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-591s21c1
Sequence:CCGGTGGACCCAAAGCCAGCATTTCCTCGAGGAAATGCTGGCTTTGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-370s21c1
Sequence:CCGGGACTGCTTCCACAGCTATTTCCTCGAGGAAATAGCTGTGGAAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-81s1c1
Sequence:CCGGGCAAATATGGATTACTGAGAACTCGAGTTCTCAGTAATCCATATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-1289s1c1
Sequence:CCGGGCTACCTTGTCCTCTACACATCTCGAGATGTGTAGAGGACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011700.1-2239s1c1
Sequence:CCGGCGTAAGGAGTTCTATCTCTCACTCGAGTGAGAGATAGAACTCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-1216s1c1
Sequence:CCGGGTGTGGTACATCCAGGACTTACTCGAGTAAGTCCTGGATGTACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-1945s1c1
Sequence:CCGGGACAAGTATGACATCATGTTACTCGAGTAACATGATGTCATACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011700
VALIDATED
VILL MISSION shRNA shRNA Plasmid DNA
villin-like
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-2174s21c1
Sequence:CCGGGCAGTGACTCAATGGTCAATGCTCGAGCATTGACCATTGAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011700.2-2399s21c1
Sequence:CCGGGTGCCACATACCCTGAAATTCCTCGAGGAATTTCAGGGTATGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-148s21c1
Sequence:CCGGGAAAGGGCTCATGGGAATTTCCTCGAGGAAATTCCCATGAGCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-709s21c1
Sequence:CCGGACCAACCTTCTGCGCATCATGCTCGAGCATGATGCGCAGAAGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-591s21c1
Sequence:CCGGTGGACCCAAAGCCAGCATTTCCTCGAGGAAATGCTGGCTTTGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-370s21c1
Sequence:CCGGGACTGCTTCCACAGCTATTTCCTCGAGGAAATAGCTGTGGAAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-81s1c1
Sequence:CCGGGCAAATATGGATTACTGAGAACTCGAGTTCTCAGTAATCCATATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-1289s1c1
Sequence:CCGGGCTACCTTGTCCTCTACACATCTCGAGATGTGTAGAGGACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011700.1-2239s1c1
Sequence:CCGGCGTAAGGAGTTCTATCTCTCACTCGAGTGAGAGATAGAACTCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-1216s1c1
Sequence:CCGGGTGTGGTACATCCAGGACTTACTCGAGTAAGTCCTGGATGTACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-1945s1c1
Sequence:CCGGGACAAGTATGACATCATGTTACTCGAGTAACATGATGTCATACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011700
VALIDATED
VILL MISSION shRNA Lentiviral Transduction Particles
villin-like
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-2174s21c1
Sequence:CCGGGCAGTGACTCAATGGTCAATGCTCGAGCATTGACCATTGAGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011700.2-2399s21c1
Sequence:CCGGGTGCCACATACCCTGAAATTCCTCGAGGAATTTCAGGGTATGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-148s21c1
Sequence:CCGGGAAAGGGCTCATGGGAATTTCCTCGAGGAAATTCCCATGAGCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-709s21c1
Sequence:CCGGACCAACCTTCTGCGCATCATGCTCGAGCATGATGCGCAGAAGGTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-591s21c1
Sequence:CCGGTGGACCCAAAGCCAGCATTTCCTCGAGGAAATGCTGGCTTTGGGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011700.2-370s21c1
Sequence:CCGGGACTGCTTCCACAGCTATTTCCTCGAGGAAATAGCTGTGGAAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-81s1c1
Sequence:CCGGGCAAATATGGATTACTGAGAACTCGAGTTCTCAGTAATCCATATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-1289s1c1
Sequence:CCGGGCTACCTTGTCCTCTACACATCTCGAGATGTGTAGAGGACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011700.1-2239s1c1
Sequence:CCGGCGTAAGGAGTTCTATCTCTCACTCGAGTGAGAGATAGAACTCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-1216s1c1
Sequence:CCGGGTGTGGTACATCCAGGACTTACTCGAGTAAGTCCTGGATGTACCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011700.1-1945s1c1
Sequence:CCGGGACAAGTATGACATCATGTTACTCGAGTAACATGATGTCATACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015873
VILL MISSION shRNA Bacterial Glycerol Stock
villin-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015873.3-490s21c1
Sequence:CCGGAGCGACTGCTGCACATCAAAGCTCGAGCTTTGATGTGCAGCAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015873.3-2266s21c1
Sequence:CCGGCATCAACCATCTCTGAGATAACTCGAGTTATCTCAGAGATGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015873.2-2552s1c1
Sequence:CCGGAGCCCTCTCGACTGCCCCTATCTCGAGATAGGGGCAGTCGAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-1883s1c1
Sequence:CCGGCCTGGACAAGTATGACATCATCTCGAGATGATGTCATACTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-1340s1c1
Sequence:CCGGCGCTGAGGAACTAGATGTCATCTCGAGATGACATCTAGTTCCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-2272s1c1
Sequence:CCGGCAGAGAATGATCTGGTGCGAACTCGAGTTCGCACCAGATCATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-1231s1c1
Sequence:CCGGGCTACCTTGTGCTCTACACATCTCGAGATGTGTAGAGCACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015873
VILL MISSION shRNA shRNA Plasmid DNA
villin-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015873.3-490s21c1
Sequence:CCGGAGCGACTGCTGCACATCAAAGCTCGAGCTTTGATGTGCAGCAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015873.3-2266s21c1
Sequence:CCGGCATCAACCATCTCTGAGATAACTCGAGTTATCTCAGAGATGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015873.2-2552s1c1
Sequence:CCGGAGCCCTCTCGACTGCCCCTATCTCGAGATAGGGGCAGTCGAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-1883s1c1
Sequence:CCGGCCTGGACAAGTATGACATCATCTCGAGATGATGTCATACTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-1340s1c1
Sequence:CCGGCGCTGAGGAACTAGATGTCATCTCGAGATGACATCTAGTTCCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-2272s1c1
Sequence:CCGGCAGAGAATGATCTGGTGCGAACTCGAGTTCGCACCAGATCATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-1231s1c1
Sequence:CCGGGCTACCTTGTGCTCTACACATCTCGAGATGTGTAGAGCACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015873
VILL MISSION shRNA Lentiviral Transduction Particles
villin-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015873.3-490s21c1
Sequence:CCGGAGCGACTGCTGCACATCAAAGCTCGAGCTTTGATGTGCAGCAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015873.3-2266s21c1
Sequence:CCGGCATCAACCATCTCTGAGATAACTCGAGTTATCTCAGAGATGGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015873.2-2552s1c1
Sequence:CCGGAGCCCTCTCGACTGCCCCTATCTCGAGATAGGGGCAGTCGAGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-1883s1c1
Sequence:CCGGCCTGGACAAGTATGACATCATCTCGAGATGATGTCATACTTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-1340s1c1
Sequence:CCGGCGCTGAGGAACTAGATGTCATCTCGAGATGACATCTAGTTCCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-2272s1c1
Sequence:CCGGCAGAGAATGATCTGGTGCGAACTCGAGTTCGCACCAGATCATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015873.2-1231s1c1
Sequence:CCGGGCTACCTTGTGCTCTACACATCTCGAGATGTGTAGAGCACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks