EMAIL THIS PAGE TO A FRIEND

VIM

vimentin

Synonyms: CTRCT30
Gene ID:
Human(7431) Summary: This gene encodes a member of the intermediate filament family. Intermediate filamentents, along with microtubules and actin microfilaments, make up the cytoskeleton. The protein encoded by this gene is responsible for maintaining cell shape, integrity of the cytoplasm, and stabilizing cytoskeletal interactions. It is also involved in the immune response, and controls the transport of low-density lipoprotein (LDL)-derived cholesterol from a lysosome to the site of esterification. It functions as an organizer of a number of critical proteins involved in attachment, migration, and cell signaling. Mutations in this gene causes a dominant, pulverulent cataract.[provided by RefSeq, Jun 2009]
Mouse(22352) vimentin
Rat(81818) vimentin
dog(477991) vimentin
chicken(420519) vimentin
Horse(100056088) vimentin
cow(280955) vimentin
sheep(443105) vimentin
Gene Class: Cytoskeleton
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504325 Anti-phospho-Vimentin (pSer56) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301438 Anti-phospho-Vimentin (pSer56) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504324 Anti-phospho-Vimentin (pSer83) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB2108610 Anti-VIM affinity isolated antibody rabbit, human, guinea pig, rat, mouse, canine, rat, bovine, horse
immunohistochemistry, western blot pricing
AV48225 Anti-VIM (AB1) antibody produced in rabbit affinity isolated antibody bovine, human, mouse, horse, rat, guinea pig, rabbit, sheep
western blot pricing
AV48226 Anti-VIM (AB2) antibody produced in rabbit affinity isolated antibody bovine, human, pig, mouse, rabbit, guinea pig, horse, zebrafish, sheep, rat
western blot pricing
SAB1406585 Anti-VIM antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA001762 Anti-VIM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306538 ANTI-VIME antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1305433 ANTI-VIMENTIN (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1305096 ANTI-VIMENTIN (S82) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
V4630 Anti-Vimentin antibody produced in goat whole antiserum wide range, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300676 Anti-Vimentin antibody produced in rabbit affinity isolated antibody human, monkey, mouse, rat
western blot pricing
SAB4503081 Anti-Vimentin antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB1305445 ANTI-VIMENTIN antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5500191 Anti-Vimentin antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP20, tissue culture supernatant human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB1305447 ANTI-VIMENTIN(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503083 Anti-Vimentin, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4503082 Anti-Vimentin, N-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
WH0007431M1 Monoclonal Anti-VIM antibody produced in mouse clone 3E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB4700524 Monoclonal Anti-VIM antibody produced in mouse clone VI-RE/1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4100612 Monoclonal Anti-VIM antibody produced in mouse clone VIM-A604, culture supernatant human
western blot pricing
AMAB90516 Monoclonal Anti-VIM antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0157, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4700525 Monoclonal Anti-VIM-PE antibody produced in mouse clone VI-RE/1, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB1305507 MONOCLONAL ANTI-VIME antibody produced in mouse clone 280CT3.4.6, purified immunoglobulin, buffered aqueous solution human
western blot pricing
V6389 Monoclonal Anti-Vimentin antibody produced in mouse ~1 mg/mL, clone V9, purified immunoglobulin, buffered aqueous solution horse, monkey, bovine, rabbit, pig, canine, gerbil, rat, chicken, human, feline, hamster
flow cytometry, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
V5255 Monoclonal Anti-Vimentin antibody produced in mouse clone VIM-13.2, ascites fluid human, frog, rat, rabbit, mouse, chicken
immunofluorescence, western blot pricing
V2258 Monoclonal Anti-Vimentin antibody produced in mouse clone LN-6, ascites fluid feline, bovine, pig, rat, rabbit, human, mouse, sheep
immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
V6630 Monoclonal Anti-Vimentin antibody produced in mouse clone V9, ascites fluid horse, monkey, bovine, rabbit, pig, canine, gerbil, rat, chicken, human, feline, hamster
immunohistochemistry, western blot pricing
C9080 Monoclonal Anti-Vimentin−Cy3 antibody produced in mouse clone V9, purified immunoglobulin, buffered aqueous solution horse, monkey, bovine, rabbit, pig, canine, gerbil, rat, chicken, human, feline, hamster
immunofluorescence, immunohistochemistry pricing
PLA0199 Rabbit anti-Vimentin Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rat, sheep, horse, human, chicken, dog, mouse, rabbit, pig, bovine, guinea pig, turkey
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003380 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003380 Rosetta Predictions human pricing
NM_031140 Rosetta Predictions rat pricing
NM_011701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044033 predicted 951
2 SASI_Hs01_00044035 predicted 1071
3 SASI_Hs01_00044036 predicted 1402
4 SASI_Hs01_00044037 predicted 1443
5 SASI_Hs01_00044038 predicted 211
6 SASI_Hs02_00335542 predicted 1486
7 SASI_Hs02_00335543 predicted 1392
8 SASI_Hs02_00335544 predicted 766
9 SASI_Hs01_00044029 predicted 1111
10 SASI_Hs02_00335545 predicted 1472
11 SASI_Hs01_00044030 predicted 738
12 SASI_Hs01_00044031 predicted 778
13 SASI_Hs01_00044032 predicted 743
14 SASI_Hs01_00044034 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046004 predicted 691
2 SASI_Rn01_00046005 predicted 347
3 SASI_Rn01_00046006 predicted 1068
4 SASI_Rn01_00046007 predicted 729
5 SASI_Rn01_00046008 predicted 1005
6 SASI_Rn01_00046009 predicted 1014
7 SASI_Rn01_00046010 predicted 619
8 SASI_Rn01_00046011 predicted 905
9 SASI_Rn01_00046012 predicted 886
10 SASI_Rn01_00046013 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131021 predicted 1627
2 SASI_Mm01_00131022 predicted 1458
3 SASI_Mm01_00131023 predicted 1474
4 SASI_Mm01_00131024 predicted 1027
5 SASI_Mm01_00131025 predicted 1625
6 SASI_Mm01_00131026 predicted 789
7 SASI_Mm01_00131027 predicted 1134
8 SASI_Mm01_00131028 predicted 1423
9 SASI_Mm01_00131029 predicted 1084
10 SASI_Mm02_00321259 predicted 1422
11 SASI_Mm01_00131020 predicted 756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003380
VALIDATED
VIM MISSION shRNA Bacterial Glycerol Stock
vimentin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1188s1c1
Sequence:CCGGGCTAACTACCAAGACACTATTCTCGAGAATAGTGTCTTGGTAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1417s1c1
Sequence:CCGGCTCTGGTTGATACCCACTCAACTCGAGTTGAGTGGGTATCAACCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1217s1c1
Sequence:CCGGGCAGGATGAGATTCAGAATATCTCGAGATATTCTGAATCTCATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-392s1c1
Sequence:CCGGCGCCATCAACACCGAGTTCAACTCGAGTTGAACTCGGTGTTGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1477s1c1
Sequence:CCGGGACAGGTTATCAACGAAACTTCTCGAGAAGTTTCGTTGATAACCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1479s21c1
Sequence:CCGGGACAGGTTATCAACGAAACTTCTCGAGAAGTTTCGTTGATAACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-394s21c1
Sequence:CCGGCGCCATCAACACCGAGTTCAACTCGAGTTGAACTCGGTGTTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1219s21c1
Sequence:CCGGGCAGGATGAGATTCAGAATATCTCGAGATATTCTGAATCTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1190s21c1
Sequence:CCGGGCTAACTACCAAGACACTATTCTCGAGAATAGTGTCTTGGTAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1419s21c1
Sequence:CCGGCTCTGGTTGATACCCACTCAACTCGAGTTGAGTGGGTATCAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003380
VALIDATED
VIM MISSION shRNA shRNA Plasmid DNA
vimentin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1188s1c1
Sequence:CCGGGCTAACTACCAAGACACTATTCTCGAGAATAGTGTCTTGGTAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1417s1c1
Sequence:CCGGCTCTGGTTGATACCCACTCAACTCGAGTTGAGTGGGTATCAACCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1217s1c1
Sequence:CCGGGCAGGATGAGATTCAGAATATCTCGAGATATTCTGAATCTCATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-392s1c1
Sequence:CCGGCGCCATCAACACCGAGTTCAACTCGAGTTGAACTCGGTGTTGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1477s1c1
Sequence:CCGGGACAGGTTATCAACGAAACTTCTCGAGAAGTTTCGTTGATAACCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1479s21c1
Sequence:CCGGGACAGGTTATCAACGAAACTTCTCGAGAAGTTTCGTTGATAACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-394s21c1
Sequence:CCGGCGCCATCAACACCGAGTTCAACTCGAGTTGAACTCGGTGTTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1219s21c1
Sequence:CCGGGCAGGATGAGATTCAGAATATCTCGAGATATTCTGAATCTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1190s21c1
Sequence:CCGGGCTAACTACCAAGACACTATTCTCGAGAATAGTGTCTTGGTAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1419s21c1
Sequence:CCGGCTCTGGTTGATACCCACTCAACTCGAGTTGAGTGGGTATCAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003380
VALIDATED
VIM MISSION shRNA Lentiviral Transduction Particles
vimentin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1188s1c1
Sequence:CCGGGCTAACTACCAAGACACTATTCTCGAGAATAGTGTCTTGGTAGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1417s1c1
Sequence:CCGGCTCTGGTTGATACCCACTCAACTCGAGTTGAGTGGGTATCAACCAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1217s1c1
Sequence:CCGGGCAGGATGAGATTCAGAATATCTCGAGATATTCTGAATCTCATCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-392s1c1
Sequence:CCGGCGCCATCAACACCGAGTTCAACTCGAGTTGAACTCGGTGTTGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003380.1-1477s1c1
Sequence:CCGGGACAGGTTATCAACGAAACTTCTCGAGAAGTTTCGTTGATAACCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1479s21c1
Sequence:CCGGGACAGGTTATCAACGAAACTTCTCGAGAAGTTTCGTTGATAACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-394s21c1
Sequence:CCGGCGCCATCAACACCGAGTTCAACTCGAGTTGAACTCGGTGTTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1219s21c1
Sequence:CCGGGCAGGATGAGATTCAGAATATCTCGAGATATTCTGAATCTCATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1190s21c1
Sequence:CCGGGCTAACTACCAAGACACTATTCTCGAGAATAGTGTCTTGGTAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003380.2-1419s21c1
Sequence:CCGGCTCTGGTTGATACCCACTCAACTCGAGTTGAGTGGGTATCAACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011701
VALIDATED
VIM MISSION shRNA Bacterial Glycerol Stock
vimentin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011701.3-717s1c1
Sequence:CCGGGCTTCAAGACTCGGTGGACTTCTCGAGAAGTCCACCGAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011701.3-1150s1c1
Sequence:CCGGGTGGAATCCTTGCAGGAAGAACTCGAGTTCTTCCTGCAAGGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011701.3-1860s1c1
Sequence:CCGGGCATCACGATGACCTTGAATACTCGAGTATTCAAGGTCATCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011701.3-1987s1c1
Sequence:CCGGGCGCAAGATAGATTTGGAATACTCGAGTATTCCAAATCTATCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011701.3-747s1c1
Sequence:CCGGCGACGCCATCAACACTGAGTTCTCGAGAACTCAGTGTTGATGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011701.4-791s21c1
Sequence:CCGGGTGGAATCCTTGCAGGAAGAACTCGAGTTCTTCCTGCAAGGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011701.4-358s21c1
Sequence:CCGGGCTTCAAGACTCGGTGGACTTCTCGAGAAGTCCACCGAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011701.4-1501s21c1
Sequence:CCGGGCATCACGATGACCTTGAATACTCGAGTATTCAAGGTCATCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011701.4-1627s21c1
Sequence:CCGGGCGCAAGATAGATTTGGAATACTCGAGTATTCCAAATCTATCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011701
VALIDATED
VIM MISSION shRNA shRNA Plasmid DNA
vimentin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011701.3-717s1c1
Sequence:CCGGGCTTCAAGACTCGGTGGACTTCTCGAGAAGTCCACCGAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011701.3-1150s1c1
Sequence:CCGGGTGGAATCCTTGCAGGAAGAACTCGAGTTCTTCCTGCAAGGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011701.3-1860s1c1
Sequence:CCGGGCATCACGATGACCTTGAATACTCGAGTATTCAAGGTCATCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011701.3-1987s1c1
Sequence:CCGGGCGCAAGATAGATTTGGAATACTCGAGTATTCCAAATCTATCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011701.3-747s1c1
Sequence:CCGGCGACGCCATCAACACTGAGTTCTCGAGAACTCAGTGTTGATGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011701.4-791s21c1
Sequence:CCGGGTGGAATCCTTGCAGGAAGAACTCGAGTTCTTCCTGCAAGGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011701.4-358s21c1
Sequence:CCGGGCTTCAAGACTCGGTGGACTTCTCGAGAAGTCCACCGAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011701.4-1501s21c1
Sequence:CCGGGCATCACGATGACCTTGAATACTCGAGTATTCAAGGTCATCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011701.4-1627s21c1
Sequence:CCGGGCGCAAGATAGATTTGGAATACTCGAGTATTCCAAATCTATCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011701
VALIDATED
VIM MISSION shRNA Lentiviral Transduction Particles
vimentin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011701.3-717s1c1
Sequence:CCGGGCTTCAAGACTCGGTGGACTTCTCGAGAAGTCCACCGAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011701.3-1150s1c1
Sequence:CCGGGTGGAATCCTTGCAGGAAGAACTCGAGTTCTTCCTGCAAGGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011701.3-1860s1c1
Sequence:CCGGGCATCACGATGACCTTGAATACTCGAGTATTCAAGGTCATCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011701.3-1987s1c1
Sequence:CCGGGCGCAAGATAGATTTGGAATACTCGAGTATTCCAAATCTATCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011701.3-747s1c1
Sequence:CCGGCGACGCCATCAACACTGAGTTCTCGAGAACTCAGTGTTGATGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011701.4-791s21c1
Sequence:CCGGGTGGAATCCTTGCAGGAAGAACTCGAGTTCTTCCTGCAAGGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011701.4-358s21c1
Sequence:CCGGGCTTCAAGACTCGGTGGACTTCTCGAGAAGTCCACCGAGTCTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011701.4-1501s21c1
Sequence:CCGGGCATCACGATGACCTTGAATACTCGAGTATTCAAGGTCATCGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011701.4-1627s21c1
Sequence:CCGGGCGCAAGATAGATTTGGAATACTCGAGTATTCCAAATCTATCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks