EMAIL THIS PAGE TO A FRIEND

VIMP

VCP-interacting membrane protein

Synonyms: ADO15 SBBI8 SELS SEPS1
UniProtKB ID: Q9BQE4, Q3B771, Q9P0I6
Gene ID:
Human(55829) Summary: This gene encodes a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Studies suggest that this protein may regulate cytokine production, and thus play a key role in the control of the inflammatory response. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(109815) VCP-interacting membrane protein
Rat(286900) VCP-interacting membrane protein
Zebrafish(735249) VCP-interacting membrane protein
dog(607791) VCP-interacting membrane protein
domestic cat(101081301) VCP-interacting membrane protein
chicken(415522) VCP-interacting membrane protein
naked mole-rat(101699120) VCP-interacting membrane protein
domestic guinea pig(100713682) VCP-interacting membrane protein
cow(512276) VCP-interacting membrane protein
sheep(101109045) VCP-interacting membrane protein
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018445 Rosetta Predictions human pricing
NM_203472 Rosetta Predictions human pricing
NM_173120 Rosetta Predictions rat pricing
NM_024439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170809 predicted 287
2 SASI_Hs01_00170810 predicted 344
3 SASI_Hs01_00170811 predicted 283
4 SASI_Hs01_00170812 predicted 285
5 SASI_Hs01_00170813 predicted 344
6 SASI_Hs02_00351978 predicted 351
7 SASI_Hs01_00170814 predicted 281
8 SASI_Hs01_00170815 predicted 313
9 SASI_Hs01_00170816 predicted 274
10 SASI_Hs01_00170817 predicted 284
11 SASI_Hs01_00170818 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100870 predicted 287
2 SASI_Hs01_00100871 predicted 345
3 SASI_Hs01_00100872 predicted 284
4 SASI_Hs01_00100873 predicted 280
5 SASI_Hs01_00100874 predicted 350
6 SASI_Hs02_00373405 predicted 344
7 SASI_Hs01_00100875 predicted 275
8 SASI_Hs01_00100876 predicted 315
9 SASI_Hs01_00100877 predicted 279
10 SASI_Hs01_00100878 predicted 284
11 SASI_Hs01_00100879 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069079 predicted 645
2 SASI_Rn01_00069081 predicted 732
3 SASI_Rn01_00069082 predicted 610
4 SASI_Rn02_00269275 predicted 260
5 SASI_Rn01_00069083 predicted 709
6 SASI_Rn02_00269276 predicted 214
7 SASI_Rn02_00269277 predicted 304
8 SASI_Rn01_00069085 predicted 585
9 SASI_Rn02_00269278 predicted 385
10 SASI_Rn01_00069087 predicted 597
11 SASI_Rn01_00069080 predicted 623
12 SASI_Rn01_00069084 predicted 709
13 SASI_Rn01_00069086 predicted 808
14 SASI_Rn01_00069088 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054118 predicted 688
2 SASI_Mm01_00054119 predicted 297
3 SASI_Mm01_00054121 predicted 771
4 SASI_Mm01_00054122 predicted 311
5 SASI_Mm02_00327768 predicted 655
6 SASI_Mm01_00054124 predicted 636
7 SASI_Mm01_00054125 predicted 743
8 SASI_Mm01_00054126 predicted 426
9 SASI_Mm01_00054127 predicted 641
10 SASI_Mm02_00327769 predicted 318
11 SASI_Mm01_00054120 predicted 781
12 SASI_Mm01_00054123 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018445
VALIDATED
VIMP MISSION shRNA Bacterial Glycerol Stock
VCP-interacting membrane protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018445.4-423s21c1
Sequence:CCGGGATTGAAATGTGGGACAGCATCTCGAGATGCTGTCCCACATTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018445.4-349s21c1
Sequence:CCGGGAAGAACTAAATGCGCAAGTTCTCGAGAACTTGCGCATTTAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018445.4-298s21c1
Sequence:CCGGGTTGTTGTTAAACGACAAGAACTCGAGTTCTTGTCGTTTAACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018445.4-201s21c1
Sequence:CCGGCATCCTTCTCTACGTGGTCTTCTCGAGAAGACCACGTAGAGAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-525s1c1
Sequence:CCGGGAAACGGAAATCGGACAGAAACTCGAGTTTCTGTCCGATTTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-298s1c1
Sequence:CCGGGTTGTTGTTAAACGACAAGAACTCGAGTTCTTGTCGTTTAACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-423s1c1
Sequence:CCGGGATTGAAATGTGGGACAGCATCTCGAGATGCTGTCCCACATTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-201s1c1
Sequence:CCGGCATCCTTCTCTACGTGGTCTTCTCGAGAAGACCACGTAGAGAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-349s1c1
Sequence:CCGGGAAGAACTAAATGCGCAAGTTCTCGAGAACTTGCGCATTTAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018445
VALIDATED
VIMP MISSION shRNA shRNA Plasmid DNA
VCP-interacting membrane protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018445.4-423s21c1
Sequence:CCGGGATTGAAATGTGGGACAGCATCTCGAGATGCTGTCCCACATTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018445.4-349s21c1
Sequence:CCGGGAAGAACTAAATGCGCAAGTTCTCGAGAACTTGCGCATTTAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018445.4-298s21c1
Sequence:CCGGGTTGTTGTTAAACGACAAGAACTCGAGTTCTTGTCGTTTAACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018445.4-201s21c1
Sequence:CCGGCATCCTTCTCTACGTGGTCTTCTCGAGAAGACCACGTAGAGAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-525s1c1
Sequence:CCGGGAAACGGAAATCGGACAGAAACTCGAGTTTCTGTCCGATTTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-298s1c1
Sequence:CCGGGTTGTTGTTAAACGACAAGAACTCGAGTTCTTGTCGTTTAACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-423s1c1
Sequence:CCGGGATTGAAATGTGGGACAGCATCTCGAGATGCTGTCCCACATTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-201s1c1
Sequence:CCGGCATCCTTCTCTACGTGGTCTTCTCGAGAAGACCACGTAGAGAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-349s1c1
Sequence:CCGGGAAGAACTAAATGCGCAAGTTCTCGAGAACTTGCGCATTTAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018445
VALIDATED
VIMP MISSION shRNA Lentiviral Transduction Particles
VCP-interacting membrane protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018445.4-423s21c1
Sequence:CCGGGATTGAAATGTGGGACAGCATCTCGAGATGCTGTCCCACATTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018445.4-349s21c1
Sequence:CCGGGAAGAACTAAATGCGCAAGTTCTCGAGAACTTGCGCATTTAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018445.4-298s21c1
Sequence:CCGGGTTGTTGTTAAACGACAAGAACTCGAGTTCTTGTCGTTTAACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018445.4-201s21c1
Sequence:CCGGCATCCTTCTCTACGTGGTCTTCTCGAGAAGACCACGTAGAGAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-525s1c1
Sequence:CCGGGAAACGGAAATCGGACAGAAACTCGAGTTTCTGTCCGATTTCCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-298s1c1
Sequence:CCGGGTTGTTGTTAAACGACAAGAACTCGAGTTCTTGTCGTTTAACAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-423s1c1
Sequence:CCGGGATTGAAATGTGGGACAGCATCTCGAGATGCTGTCCCACATTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-201s1c1
Sequence:CCGGCATCCTTCTCTACGTGGTCTTCTCGAGAAGACCACGTAGAGAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018445.4-349s1c1
Sequence:CCGGGAAGAACTAAATGCGCAAGTTCTCGAGAACTTGCGCATTTAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024439
VALIDATED
VIMP MISSION shRNA Bacterial Glycerol Stock
VCP-interacting membrane protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024439.2-308s1c1
Sequence:CCGGGCTCGTTTGAGAATGCAGGAACTCGAGTTCCTGCATTCTCAAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024439.2-957s1c1
Sequence:CCGGGCGTTGAATGATGTCTTCCTTCTCGAGAAGGAAGACATCATTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024439.2-958s1c1
Sequence:CCGGCGTTGAATGATGTCTTCCTTACTCGAGTAAGGAAGACATCATTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024439.2-870s1c1
Sequence:CCGGGCTGTTTAGCAGACTTCATAACTCGAGTTATGAAGTCTGCTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024439.2-323s1c1
Sequence:CCGGCAGGAAGATCTAAATGCCCAACTCGAGTTGGGCATTTAGATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024439.2-400s1c1
Sequence:CCGGGATTGAAATGTGGGACAGCATCTCGAGATGCTGTCCCACATTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024439.2-528s1c1
Sequence:CCGGCTTTGCGAGGAGGTGGTTATACTCGAGTATAACCACCTCCTCGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024439
VALIDATED
VIMP MISSION shRNA shRNA Plasmid DNA
VCP-interacting membrane protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024439.2-308s1c1
Sequence:CCGGGCTCGTTTGAGAATGCAGGAACTCGAGTTCCTGCATTCTCAAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024439.2-957s1c1
Sequence:CCGGGCGTTGAATGATGTCTTCCTTCTCGAGAAGGAAGACATCATTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024439.2-958s1c1
Sequence:CCGGCGTTGAATGATGTCTTCCTTACTCGAGTAAGGAAGACATCATTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024439.2-870s1c1
Sequence:CCGGGCTGTTTAGCAGACTTCATAACTCGAGTTATGAAGTCTGCTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024439.2-323s1c1
Sequence:CCGGCAGGAAGATCTAAATGCCCAACTCGAGTTGGGCATTTAGATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024439.2-400s1c1
Sequence:CCGGGATTGAAATGTGGGACAGCATCTCGAGATGCTGTCCCACATTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024439.2-528s1c1
Sequence:CCGGCTTTGCGAGGAGGTGGTTATACTCGAGTATAACCACCTCCTCGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024439
VALIDATED
VIMP MISSION shRNA Lentiviral Transduction Particles
VCP-interacting membrane protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024439.2-308s1c1
Sequence:CCGGGCTCGTTTGAGAATGCAGGAACTCGAGTTCCTGCATTCTCAAACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194513    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024439.2-957s1c1
Sequence:CCGGGCGTTGAATGATGTCTTCCTTCTCGAGAAGGAAGACATCATTCAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024439.2-958s1c1
Sequence:CCGGCGTTGAATGATGTCTTCCTTACTCGAGTAAGGAAGACATCATTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024439.2-870s1c1
Sequence:CCGGGCTGTTTAGCAGACTTCATAACTCGAGTTATGAAGTCTGCTAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024439.2-323s1c1
Sequence:CCGGCAGGAAGATCTAAATGCCCAACTCGAGTTGGGCATTTAGATCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024439.2-400s1c1
Sequence:CCGGGATTGAAATGTGGGACAGCATCTCGAGATGCTGTCCCACATTTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024439.2-528s1c1
Sequence:CCGGCTTTGCGAGGAGGTGGTTATACTCGAGTATAACCACCTCCTCGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks