EMAIL THIS PAGE TO A FRIEND

VIP

vasoactive intestinal peptide

Synonyms: PHM27
UniProtKB ID: P01282, Q5TCY8, Q5TCY9, Q96QK3
Gene ID:
Human(7432) Summary: The protein encoded by this gene belongs to the glucagon family. It stimulates myocardial contractility, causes vasodilation, increases glycogenolysis, lowers arterial blood pressure and relaxes the smooth muscle of trachea, stomach and gall bladder. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(22353) vasoactive intestinal polypeptide
Rat(117064) vasoactive intestinal peptide
Zebrafish(795653) vasoactive intestinal peptide
chicken(396323) vasoactive intestinal peptide
dog(484038) vasoactive intestinal peptide
domestic cat(101101640) vasoactive intestinal peptide
cow(280956) vasoactive intestinal peptide
sheep(100145884) vasoactive intestinal peptide
domestic guinea pig(100735454) vasoactive intestinal peptide
naked mole-rat(101713745) vasoactive intestinal peptide
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003381 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072751 MISSION® esiRNA esiRNA human VIP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003381 Rosetta Predictions human pricing
NM_194435 Rosetta Predictions human pricing
XM_001065820 Rosetta Predictions rat pricing
XM_217838 Rosetta Predictions rat pricing
NM_011702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033713 predicted 837
2 SASI_Hs01_00033714 predicted 1140
3 SASI_Hs01_00033716 predicted 832
4 SASI_Hs01_00033717 predicted 938
5 SASI_Hs01_00033718 predicted 933
6 SASI_Hs01_00033719 predicted 841
7 SASI_Hs01_00033720 predicted 707
8 SASI_Hs02_00335546 predicted 203
9 SASI_Hs02_00335547 predicted 843
10 SASI_Hs02_00335548 predicted 770
11 SASI_Hs01_00033712 predicted 829
12 SASI_Hs01_00033715 predicted 873
13 SASI_Hs01_00033721 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096445 predicted 834
2 SASI_Hs01_00096446 predicted 1133
3 SASI_Hs01_00096448 predicted 820
4 SASI_Hs01_00096449 predicted 943
5 SASI_Hs01_00096450 predicted 927
6 SASI_Hs01_00096451 predicted 833
7 SASI_Hs01_00096452 predicted 707
8 SASI_Hs02_00371500 predicted 212
9 SASI_Hs02_00371501 predicted 835
10 SASI_Hs02_00371502 predicted 765
11 SASI_Hs01_00096444 predicted 829
12 SASI_Hs01_00096447 predicted 868
13 SASI_Hs01_00096453 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315461 predicted 720
2 SASI_Rn02_00315462 predicted 318
3 SASI_Rn02_00315463 predicted 720
4 SASI_Rn02_00315464 predicted 454
5 SASI_Rn02_00315465 predicted 513
6 SASI_Rn02_00315466 predicted 700
7 SASI_Rn02_00315467 predicted 346
8 SASI_Rn02_00315468 predicted 568
9 SASI_Rn02_00315469 predicted 339
10 SASI_Rn02_00315470 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377367 predicted 718
2 SASI_Rn02_00377368 predicted 317
3 SASI_Rn02_00377369 predicted 720
4 SASI_Rn02_00377370 predicted 450
5 SASI_Rn02_00377371 predicted 514
6 SASI_Rn02_00377372 predicted 701
7 SASI_Rn02_00377373 predicted 353
8 SASI_Rn02_00377374 predicted 568
9 SASI_Rn02_00377375 predicted 333
10 SASI_Rn02_00377376 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148148 predicted 960
2 SASI_Mm01_00148149 predicted 473
3 SASI_Mm01_00148150 predicted 938
4 SASI_Mm01_00148151 predicted 241
5 SASI_Mm01_00148152 predicted 901
6 SASI_Mm01_00148153 predicted 751
7 SASI_Mm01_00148154 predicted 951
8 SASI_Mm02_00321260 predicted 649
9 SASI_Mm01_00148155 predicted 734
10 SASI_Mm01_00148156 predicted 431
11 SASI_Mm01_00148157 predicted 382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003381
VIP MISSION shRNA Bacterial Glycerol Stock
vasoactive intestinal peptide
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003381.2-1142s1c1
Sequence:CCGGGCTGTGTTAAATAAACCTCAACTCGAGTTGAGGTTTATTTAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-384s1c1
Sequence:CCGGCCTATTATGATGTATCCAGAACTCGAGTTCTGGATACATCATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-533s1c1
Sequence:CCGGCCAGTCAAACGTCACTCAGATCTCGAGATCTGAGTGACGTTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-656s1c1
Sequence:CCGGCCCGACTTTCCAGAAGAGTTACTCGAGTAACTCTTCTGGAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-564s1c1
Sequence:CCGGCTGACAACTATACCCGCCTTACTCGAGTAAGGCGGGTATAGTTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003381.2-1065s21c1
Sequence:CCGGATAGAGTGTACTTAACTATTCCTCGAGGAATAGTTAAGTACACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003381.2-993s21c1
Sequence:CCGGTGCTAGGTTAATTCCAATTATCTCGAGATAATTGGAATTAACCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003381
VIP MISSION shRNA shRNA Plasmid DNA
vasoactive intestinal peptide
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003381.2-1142s1c1
Sequence:CCGGGCTGTGTTAAATAAACCTCAACTCGAGTTGAGGTTTATTTAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-384s1c1
Sequence:CCGGCCTATTATGATGTATCCAGAACTCGAGTTCTGGATACATCATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-533s1c1
Sequence:CCGGCCAGTCAAACGTCACTCAGATCTCGAGATCTGAGTGACGTTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-656s1c1
Sequence:CCGGCCCGACTTTCCAGAAGAGTTACTCGAGTAACTCTTCTGGAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-564s1c1
Sequence:CCGGCTGACAACTATACCCGCCTTACTCGAGTAAGGCGGGTATAGTTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003381.2-1065s21c1
Sequence:CCGGATAGAGTGTACTTAACTATTCCTCGAGGAATAGTTAAGTACACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003381.2-993s21c1
Sequence:CCGGTGCTAGGTTAATTCCAATTATCTCGAGATAATTGGAATTAACCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003381
VIP MISSION shRNA Lentiviral Transduction Particles
vasoactive intestinal peptide
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003381.2-1142s1c1
Sequence:CCGGGCTGTGTTAAATAAACCTCAACTCGAGTTGAGGTTTATTTAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-384s1c1
Sequence:CCGGCCTATTATGATGTATCCAGAACTCGAGTTCTGGATACATCATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-533s1c1
Sequence:CCGGCCAGTCAAACGTCACTCAGATCTCGAGATCTGAGTGACGTTTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-656s1c1
Sequence:CCGGCCCGACTTTCCAGAAGAGTTACTCGAGTAACTCTTCTGGAAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003381.2-564s1c1
Sequence:CCGGCTGACAACTATACCCGCCTTACTCGAGTAAGGCGGGTATAGTTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003381.2-1065s21c1
Sequence:CCGGATAGAGTGTACTTAACTATTCCTCGAGGAATAGTTAAGTACACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003381.2-993s21c1
Sequence:CCGGTGCTAGGTTAATTCCAATTATCTCGAGATAATTGGAATTAACCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011702
VALIDATED
VIP MISSION shRNA Bacterial Glycerol Stock
vasoactive intestinal peptide
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-1330s1c1
Sequence:CCGGGCGTGTGCTATGGATGTGTAACTCGAGTTACACATCCATAGCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-203s1c1
Sequence:CCGGGATACTCTTCAGTGTGCTGTTCTCGAGAACAGCACACTGAAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-528s1c1
Sequence:CCGGCCAATCAAACGACACTCTGATCTCGAGATCAGAGTGTCGTTTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-379s1c1
Sequence:CCGGCCTATTATGATGTGTCAAGAACTCGAGTTCTTGACACATCATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011702.1-447s1c1
Sequence:CCGGCTGGGTCAGATTTCTGCCAAACTCGAGTTTGGCAGAAATCTGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011702.2-276s21c1
Sequence:CCGGTGGATGACAGGATGCCGTTTGCTCGAGCAAACGGCATCCTGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011702.2-1329s21c1
Sequence:CCGGGCGTGTGCTATGGATGTGTAACTCGAGTTACACATCCATAGCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011702.2-439s21c1
Sequence:CCGGCAGACTTCTGGGTCAGATTTCCTCGAGGAAATCTGACCCAGAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011702.2-544s21c1
Sequence:CCGGTGATGCCGTCTTCACAGATAACTCGAGTTATCTGTGAAGACGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011702.2-603s21c1
Sequence:CCGGACCTGAACTCCATCCTGAATGCTCGAGCATTCAGGATGGAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011702.2-308s21c1
Sequence:CCGGGACCCTGACCAAGTCTCTTTACTCGAGTAAAGAGACTTGGTCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011702
VALIDATED
VIP MISSION shRNA shRNA Plasmid DNA
vasoactive intestinal peptide
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-1330s1c1
Sequence:CCGGGCGTGTGCTATGGATGTGTAACTCGAGTTACACATCCATAGCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-203s1c1
Sequence:CCGGGATACTCTTCAGTGTGCTGTTCTCGAGAACAGCACACTGAAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-528s1c1
Sequence:CCGGCCAATCAAACGACACTCTGATCTCGAGATCAGAGTGTCGTTTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-379s1c1
Sequence:CCGGCCTATTATGATGTGTCAAGAACTCGAGTTCTTGACACATCATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011702.1-447s1c1
Sequence:CCGGCTGGGTCAGATTTCTGCCAAACTCGAGTTTGGCAGAAATCTGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011702.2-276s21c1
Sequence:CCGGTGGATGACAGGATGCCGTTTGCTCGAGCAAACGGCATCCTGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011702.2-1329s21c1
Sequence:CCGGGCGTGTGCTATGGATGTGTAACTCGAGTTACACATCCATAGCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011702.2-439s21c1
Sequence:CCGGCAGACTTCTGGGTCAGATTTCCTCGAGGAAATCTGACCCAGAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011702.2-544s21c1
Sequence:CCGGTGATGCCGTCTTCACAGATAACTCGAGTTATCTGTGAAGACGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011702.2-603s21c1
Sequence:CCGGACCTGAACTCCATCCTGAATGCTCGAGCATTCAGGATGGAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011702.2-308s21c1
Sequence:CCGGGACCCTGACCAAGTCTCTTTACTCGAGTAAAGAGACTTGGTCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011702
VALIDATED
VIP MISSION shRNA Lentiviral Transduction Particles
vasoactive intestinal peptide
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-1330s1c1
Sequence:CCGGGCGTGTGCTATGGATGTGTAACTCGAGTTACACATCCATAGCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-203s1c1
Sequence:CCGGGATACTCTTCAGTGTGCTGTTCTCGAGAACAGCACACTGAAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-528s1c1
Sequence:CCGGCCAATCAAACGACACTCTGATCTCGAGATCAGAGTGTCGTTTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011702.1-379s1c1
Sequence:CCGGCCTATTATGATGTGTCAAGAACTCGAGTTCTTGACACATCATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011702.1-447s1c1
Sequence:CCGGCTGGGTCAGATTTCTGCCAAACTCGAGTTTGGCAGAAATCTGACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011702.2-276s21c1
Sequence:CCGGTGGATGACAGGATGCCGTTTGCTCGAGCAAACGGCATCCTGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011702.2-1329s21c1
Sequence:CCGGGCGTGTGCTATGGATGTGTAACTCGAGTTACACATCCATAGCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011702.2-439s21c1
Sequence:CCGGCAGACTTCTGGGTCAGATTTCCTCGAGGAAATCTGACCCAGAAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011702.2-544s21c1
Sequence:CCGGTGATGCCGTCTTCACAGATAACTCGAGTTATCTGTGAAGACGGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011702.2-603s21c1
Sequence:CCGGACCTGAACTCCATCCTGAATGCTCGAGCATTCAGGATGGAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011702.2-308s21c1
Sequence:CCGGGACCCTGACCAAGTCTCTTTACTCGAGTAAAGAGACTTGGTCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks