EMAIL THIS PAGE TO A FRIEND

VIPAS39

VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog

Synonyms: C14orf133 SPE-39 SPE39 VIPAR VPS16B hSPE-39
UniProtKB ID: Q9H9C1, B4DPI6, O95434, Q9H7E1, Q9H9I9
Gene ID:
Human(63894) Summary: This gene encodes a protein involved in the sorting of lysosomal proteins. Mutations in this gene are associated with ARCS2 (arthrogryposis, renal dysfunction, and cholestasis-2). Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
Mouse(104799) VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Rat(681989) VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
naked mole-rat(101703880) VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
domestic guinea pig(100718499) VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
cow(508872) VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
sheep(101114525) VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Zebrafish(415096) VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
dog(490808) VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
domestic cat(101080801) VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134044 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134044 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134044 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022067 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022067 Rosetta Predictions human pricing
NM_001101004 Rosetta Predictions rat pricing
NM_134044 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039695 predicted 1512
2 SASI_Hs01_00039696 predicted 773
3 SASI_Hs01_00039697 predicted 1653
4 SASI_Hs02_00355432 predicted 400
5 SASI_Hs01_00039698 predicted 1807
6 SASI_Hs01_00039700 predicted 1181
7 SASI_Hs01_00039701 predicted 964
8 SASI_Hs01_00039702 predicted 803
9 SASI_Hs01_00039703 predicted 1315
10 SASI_Hs01_00039704 predicted 606
11 SASI_Hs01_00039699 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211166 predicted 1163
2 SASI_Rn02_00211167 predicted 956
3 SASI_Rn02_00211168 predicted 1108
4 SASI_Rn02_00211169 predicted 683
5 SASI_Rn02_00211170 predicted 405
6 SASI_Rn02_00211171 predicted 976
7 SASI_Rn02_00211172 predicted 244
8 SASI_Rn02_00211173 predicted 518
9 SASI_Rn02_00211174 predicted 847
10 SASI_Rn02_00211175 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134044 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176127 predicted 1170
2 SASI_Mm01_00176128 predicted 1102
3 SASI_Mm02_00339212 predicted 1502
4 SASI_Mm01_00176129 predicted 196
5 SASI_Mm01_00176130 predicted 1269
6 SASI_Mm01_00176131 predicted 506
7 SASI_Mm01_00176132 predicted 413
8 SASI_Mm01_00176133 predicted 1415
9 SASI_Mm01_00176134 predicted 235
10 SASI_Mm01_00176135 predicted 1006
11 SASI_Mm01_00176136 predicted 1406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134044
VALIDATED
VIPAS39 MISSION shRNA Bacterial Glycerol Stock
VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134044.3-1532s21c1
Sequence:CCGGCATTCTCAGCAGCTCGCAAATCTCGAGATTTGCGAGCTGCTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134044.3-227s21c1
Sequence:CCGGTGATGAGCTCTCACAGTTAAACTCGAGTTTAACTGTGAGAGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134044.3-2034s21c1
Sequence:CCGGTCGGAAAGGGATATCAGTATTCTCGAGAATACTGATATCCCTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134044.3-487s21c1
Sequence:CCGGGTAGAACTAGACCTGGGAGTTCTCGAGAACTCCCAGGTCTAGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134044.3-1303s21c1
Sequence:CCGGGCTTCCATCGAGTTGTGGAAACTCGAGTTTCCACAACTCGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134044.2-1725s1c1
Sequence:CCGGCCAGCCTTTGAGCACATGTATCTCGAGATACATGTGCTCAAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-204s1c1
Sequence:CCGGCCAAGTTCAAGGCTTTCACTTCTCGAGAAGTGAAAGCCTTGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-1314s1c1
Sequence:CCGGGCTTCCATCGAGTTGTGGAAACTCGAGTTTCCACAACTCGATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134044.2-1418s1c1
Sequence:CCGGGCTACTAAGTTCAAGTGCCATCTCGAGATGGCACTTGAACTTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-498s1c1
Sequence:CCGGGTAGAACTAGACCTGGGAGTTCTCGAGAACTCCCAGGTCTAGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-1987s1c1
Sequence:CCGGGCATAGGCATTTCACTCTAAACTCGAGTTTAGAGTGAAATGCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134044
VALIDATED
VIPAS39 MISSION shRNA shRNA Plasmid DNA
VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134044.3-1532s21c1
Sequence:CCGGCATTCTCAGCAGCTCGCAAATCTCGAGATTTGCGAGCTGCTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134044.3-227s21c1
Sequence:CCGGTGATGAGCTCTCACAGTTAAACTCGAGTTTAACTGTGAGAGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134044.3-2034s21c1
Sequence:CCGGTCGGAAAGGGATATCAGTATTCTCGAGAATACTGATATCCCTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134044.3-487s21c1
Sequence:CCGGGTAGAACTAGACCTGGGAGTTCTCGAGAACTCCCAGGTCTAGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134044.3-1303s21c1
Sequence:CCGGGCTTCCATCGAGTTGTGGAAACTCGAGTTTCCACAACTCGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134044.2-1725s1c1
Sequence:CCGGCCAGCCTTTGAGCACATGTATCTCGAGATACATGTGCTCAAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-204s1c1
Sequence:CCGGCCAAGTTCAAGGCTTTCACTTCTCGAGAAGTGAAAGCCTTGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-1314s1c1
Sequence:CCGGGCTTCCATCGAGTTGTGGAAACTCGAGTTTCCACAACTCGATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134044.2-1418s1c1
Sequence:CCGGGCTACTAAGTTCAAGTGCCATCTCGAGATGGCACTTGAACTTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-498s1c1
Sequence:CCGGGTAGAACTAGACCTGGGAGTTCTCGAGAACTCCCAGGTCTAGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-1987s1c1
Sequence:CCGGGCATAGGCATTTCACTCTAAACTCGAGTTTAGAGTGAAATGCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134044
VALIDATED
VIPAS39 MISSION shRNA Lentiviral Transduction Particles
VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134044.3-1532s21c1
Sequence:CCGGCATTCTCAGCAGCTCGCAAATCTCGAGATTTGCGAGCTGCTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134044.3-227s21c1
Sequence:CCGGTGATGAGCTCTCACAGTTAAACTCGAGTTTAACTGTGAGAGCTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134044.3-2034s21c1
Sequence:CCGGTCGGAAAGGGATATCAGTATTCTCGAGAATACTGATATCCCTTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134044.3-487s21c1
Sequence:CCGGGTAGAACTAGACCTGGGAGTTCTCGAGAACTCCCAGGTCTAGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134044.3-1303s21c1
Sequence:CCGGGCTTCCATCGAGTTGTGGAAACTCGAGTTTCCACAACTCGATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194357    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134044.2-1725s1c1
Sequence:CCGGCCAGCCTTTGAGCACATGTATCTCGAGATACATGTGCTCAAAGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-204s1c1
Sequence:CCGGCCAAGTTCAAGGCTTTCACTTCTCGAGAAGTGAAAGCCTTGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-1314s1c1
Sequence:CCGGGCTTCCATCGAGTTGTGGAAACTCGAGTTTCCACAACTCGATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134044.2-1418s1c1
Sequence:CCGGGCTACTAAGTTCAAGTGCCATCTCGAGATGGCACTTGAACTTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-498s1c1
Sequence:CCGGGTAGAACTAGACCTGGGAGTTCTCGAGAACTCCCAGGTCTAGTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134044.2-1987s1c1
Sequence:CCGGGCATAGGCATTTCACTCTAAACTCGAGTTTAGAGTGAAATGCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022067
VALIDATED
VIPAS39 MISSION shRNA Bacterial Glycerol Stock
VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-1406s21c1
Sequence:CCGGCAACCTGAAGAAGACATTTAACTCGAGTTAAATGTCTTCTTCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-911s21c1
Sequence:CCGGGCATGATGGAAACGTCATTACCTCGAGGTAATGACGTTTCCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-1558s21c1
Sequence:CCGGTCCATCGGGTTGTCGAAATTTCTCGAGAAATTTCGACAACCCGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-2171s21c1
Sequence:CCGGTGCATTCCACTCAGCTAATTACTCGAGTAATTAGCTGAGTGGAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-1091s21c1
Sequence:CCGGAGAGCTTGCGCTATCTCATTACTCGAGTAATGAGATAGCGCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022067.2-1199s1c1
Sequence:CCGGCGCACACATACAGGACCATTACTCGAGTAATGGTCCTGTATGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022067
VALIDATED
VIPAS39 MISSION shRNA shRNA Plasmid DNA
VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-1406s21c1
Sequence:CCGGCAACCTGAAGAAGACATTTAACTCGAGTTAAATGTCTTCTTCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-911s21c1
Sequence:CCGGGCATGATGGAAACGTCATTACCTCGAGGTAATGACGTTTCCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-1558s21c1
Sequence:CCGGTCCATCGGGTTGTCGAAATTTCTCGAGAAATTTCGACAACCCGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-2171s21c1
Sequence:CCGGTGCATTCCACTCAGCTAATTACTCGAGTAATTAGCTGAGTGGAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-1091s21c1
Sequence:CCGGAGAGCTTGCGCTATCTCATTACTCGAGTAATGAGATAGCGCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022067.2-1199s1c1
Sequence:CCGGCGCACACATACAGGACCATTACTCGAGTAATGGTCCTGTATGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022067
VALIDATED
VIPAS39 MISSION shRNA Lentiviral Transduction Particles
VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-1406s21c1
Sequence:CCGGCAACCTGAAGAAGACATTTAACTCGAGTTAAATGTCTTCTTCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-911s21c1
Sequence:CCGGGCATGATGGAAACGTCATTACCTCGAGGTAATGACGTTTCCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-1558s21c1
Sequence:CCGGTCCATCGGGTTGTCGAAATTTCTCGAGAAATTTCGACAACCCGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-2171s21c1
Sequence:CCGGTGCATTCCACTCAGCTAATTACTCGAGTAATTAGCTGAGTGGAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022067.2-1091s21c1
Sequence:CCGGAGAGCTTGCGCTATCTCATTACTCGAGTAATGAGATAGCGCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022067.2-1199s1c1
Sequence:CCGGCGCACACATACAGGACCATTACTCGAGTAATGGTCCTGTATGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks