EMAIL THIS PAGE TO A FRIEND

VIPR1

vasoactive intestinal peptide receptor 1

Synonyms: HVR1 II PACAP-R-2 PACAP-R2 RDC1 V1RG VAPC1 VIP-R-1 VIPR VIRG VPAC1 VPAC1R VPCAP1R
Gene ID:
Human(7433) Summary: This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(22354) vasoactive intestinal peptide receptor 1
Rat(24875) vasoactive intestinal peptide receptor 1
chicken(395329) vasoactive intestinal peptide receptor 1
dog(477035) vasoactive intestinal peptide receptor 1
domestic cat(101096346) vasoactive intestinal peptide receptor 1
cow(535858) vasoactive intestinal peptide receptor 1
sheep(100500782) vasoactive intestinal peptide receptor 1
domestic guinea pig(100735582) vasoactive intestinal peptide receptor 1
naked mole-rat(101718234) vasoactive intestinal peptide receptor 1
Domestic Rabbit(100009518) vasoactive intestinal peptide receptor 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004624 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004624 siRNAs that have been validated in the lab human pricing
NM_012685 Rosetta Predictions rat pricing
NM_011703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004624 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213639 validated 393
2 SASI_Hs01_00213638 predicted 1963
3 SASI_Hs01_00213640 predicted 1147
4 SASI_Hs01_00213641 predicted 771
5 SASI_Hs01_00213642 predicted 1085
6 SASI_Hs01_00213643 predicted 1943
7 SASI_Hs01_00213645 predicted 1962
8 SASI_Hs01_00213646 predicted 393
9 SASI_Hs01_00213647 predicted 783
10 SASI_Hs02_00338021 predicted 1930
11 SASI_Hs01_00213644 predicted 1953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012685 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045180 predicted 1089
2 SASI_Rn01_00045182 predicted 597
3 SASI_Rn01_00045183 predicted 1181
4 SASI_Rn01_00045184 predicted 403
5 SASI_Rn01_00045186 predicted 760
6 SASI_Rn01_00045187 predicted 491
7 SASI_Rn02_00259983 predicted 1008
8 SASI_Rn01_00045188 predicted 676
9 SASI_Rn01_00045189 predicted 274
10 SASI_Rn02_00259984 predicted 1091
11 SASI_Rn01_00045181 predicted 935
12 SASI_Rn01_00045185 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185444 predicted 240
2 SASI_Mm01_00185445 predicted 416
3 SASI_Mm02_00321261 predicted 554
4 SASI_Mm01_00185446 predicted 948
5 SASI_Mm01_00185449 predicted 1598
6 SASI_Mm01_00185451 predicted 507
7 SASI_Mm01_00185452 predicted 1042
8 SASI_Mm02_00321262 predicted 716
9 SASI_Mm02_00321263 predicted 1226
10 SASI_Mm02_00321264 predicted 504
11 SASI_Mm01_00185447 predicted 1166
12 SASI_Mm01_00185448 predicted 1147
13 SASI_Mm01_00185450 predicted 980
14 SASI_Mm01_00185453 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011703
VIPR1 MISSION shRNA Bacterial Glycerol Stock
vasoactive intestinal peptide receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-425s1c1
Sequence:CCGGCGGCTATAACATCAGCCGTAACTCGAGTTACGGCTGATGTTATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-1067s1c1
Sequence:CCGGCATCCTGTTTATCTGCATCATCTCGAGATGATGCAGATAAACAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-533s1c1
Sequence:CCGGGCAGCAACAGACTGAGTTCTACTCGAGTAGAACTCAGTCTGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-1089s1c1
Sequence:CCGGCGAATCCTGGTTCAGAAGCTACTCGAGTAGCTTCTGAACCAGGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-1265s1c1
Sequence:CCGGCGTAGGGTCTTTCCAGGGTTTCTCGAGAAACCCTGGAAAGACCCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011703
VIPR1 MISSION shRNA shRNA Plasmid DNA
vasoactive intestinal peptide receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-425s1c1
Sequence:CCGGCGGCTATAACATCAGCCGTAACTCGAGTTACGGCTGATGTTATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-1067s1c1
Sequence:CCGGCATCCTGTTTATCTGCATCATCTCGAGATGATGCAGATAAACAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-533s1c1
Sequence:CCGGGCAGCAACAGACTGAGTTCTACTCGAGTAGAACTCAGTCTGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-1089s1c1
Sequence:CCGGCGAATCCTGGTTCAGAAGCTACTCGAGTAGCTTCTGAACCAGGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-1265s1c1
Sequence:CCGGCGTAGGGTCTTTCCAGGGTTTCTCGAGAAACCCTGGAAAGACCCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011703
VIPR1 MISSION shRNA Lentiviral Transduction Particles
vasoactive intestinal peptide receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-425s1c1
Sequence:CCGGCGGCTATAACATCAGCCGTAACTCGAGTTACGGCTGATGTTATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-1067s1c1
Sequence:CCGGCATCCTGTTTATCTGCATCATCTCGAGATGATGCAGATAAACAGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-533s1c1
Sequence:CCGGGCAGCAACAGACTGAGTTCTACTCGAGTAGAACTCAGTCTGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-1089s1c1
Sequence:CCGGCGAATCCTGGTTCAGAAGCTACTCGAGTAGCTTCTGAACCAGGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011703.2-1265s1c1
Sequence:CCGGCGTAGGGTCTTTCCAGGGTTTCTCGAGAAACCCTGGAAAGACCCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004624
VIPR1 MISSION shRNA Bacterial Glycerol Stock
vasoactive intestinal peptide receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-1206s1c1
Sequence:CCGGCCTGAAGTGAAGATGGTCTTTCTCGAGAAAGACCATCTTCACTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-1013s1c1
Sequence:CCGGCCTCACCTCCATCTTGGTAAACTCGAGTTTACCAAGATGGAGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-1181s1c1
Sequence:CCGGCGCCTTCTTTCCGGACAATTTCTCGAGAAATTGTCCGGAAAGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-647s1c1
Sequence:CCGGGCACCTCTTCATATCCTTCATCTCGAGATGAAGGATATGAAGAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004624.2-1948s1c1
Sequence:CCGGGCTGTCAAGTTCCTTTGGGTTCTCGAGAACCCAAAGGAACTTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004624.3-1194s21c1
Sequence:CCGGTCGCCTTCTTTCCGGACAATTCTCGAGAATTGTCCGGAAAGAAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004624.3-943s21c1
Sequence:CCGGGACCATCGCCAGGATCCATTTCTCGAGAAATGGATCCTGGCGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004624.3-996s21c1
Sequence:CCGGCCTCACTGTGGTGGATCATAACTCGAGTTATGATCCACCACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004624
VIPR1 MISSION shRNA shRNA Plasmid DNA
vasoactive intestinal peptide receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-1206s1c1
Sequence:CCGGCCTGAAGTGAAGATGGTCTTTCTCGAGAAAGACCATCTTCACTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-1013s1c1
Sequence:CCGGCCTCACCTCCATCTTGGTAAACTCGAGTTTACCAAGATGGAGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-1181s1c1
Sequence:CCGGCGCCTTCTTTCCGGACAATTTCTCGAGAAATTGTCCGGAAAGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-647s1c1
Sequence:CCGGGCACCTCTTCATATCCTTCATCTCGAGATGAAGGATATGAAGAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004624.2-1948s1c1
Sequence:CCGGGCTGTCAAGTTCCTTTGGGTTCTCGAGAACCCAAAGGAACTTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004624.3-1194s21c1
Sequence:CCGGTCGCCTTCTTTCCGGACAATTCTCGAGAATTGTCCGGAAAGAAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004624.3-943s21c1
Sequence:CCGGGACCATCGCCAGGATCCATTTCTCGAGAAATGGATCCTGGCGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004624.3-996s21c1
Sequence:CCGGCCTCACTGTGGTGGATCATAACTCGAGTTATGATCCACCACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004624
VIPR1 MISSION shRNA Lentiviral Transduction Particles
vasoactive intestinal peptide receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-1206s1c1
Sequence:CCGGCCTGAAGTGAAGATGGTCTTTCTCGAGAAAGACCATCTTCACTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-1013s1c1
Sequence:CCGGCCTCACCTCCATCTTGGTAAACTCGAGTTTACCAAGATGGAGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-1181s1c1
Sequence:CCGGCGCCTTCTTTCCGGACAATTTCTCGAGAAATTGTCCGGAAAGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004624.2-647s1c1
Sequence:CCGGGCACCTCTTCATATCCTTCATCTCGAGATGAAGGATATGAAGAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004624.2-1948s1c1
Sequence:CCGGGCTGTCAAGTTCCTTTGGGTTCTCGAGAACCCAAAGGAACTTGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004624.3-1194s21c1
Sequence:CCGGTCGCCTTCTTTCCGGACAATTCTCGAGAATTGTCCGGAAAGAAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004624.3-943s21c1
Sequence:CCGGGACCATCGCCAGGATCCATTTCTCGAGAAATGGATCCTGGCGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004624.3-996s21c1
Sequence:CCGGCCTCACTGTGGTGGATCATAACTCGAGTTATGATCCACCACAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks