EMAIL THIS PAGE TO A FRIEND

VIPR2

vasoactive intestinal peptide receptor 2

Synonyms: C16DUPq36.3 DUP7q36.3 PACAP-R-3 PACAP-R3 VIP-R-2 VPAC2 VPAC2R VPCAP2R
UniProtKB ID: P41587, Q13053, Q15870, Q53Y09, Q9UCW0
Gene ID:
Human(7434) Summary: This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. [provided by RefSeq, Aug 2011]
Mouse(22355) vasoactive intestinal peptide receptor 2
Rat(29555) vasoactive intestinal peptide receptor 2
Zebrafish(81886) vasoactive intestinal peptide receptor 2
domestic cat(101086131) vasoactive intestinal peptide receptor 2
dog(611663) vasoactive intestinal peptide receptor 2
chicken(420453) vasoactive intestinal peptide receptor 2
Domestic Rabbit(100009382) vasoactive intestinal peptide receptor 2
naked mole-rat(101712920) vasoactive intestinal peptide receptor 2
domestic guinea pig(100379253) vasoactive intestinal peptide receptor 2
cow(790124) vasoactive intestinal peptide receptor 2
sheep(100500781) vasoactive intestinal peptide receptor 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003382 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017371 MISSION® esiRNA esiRNA targeting mouse Vipr2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003382 Rosetta Predictions human pricing
NM_017238 Rosetta Predictions rat pricing
NM_009511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164326 predicted 703
2 SASI_Hs01_00164328 predicted 600
3 SASI_Hs01_00164333 predicted 662
4 SASI_Hs01_00164334 predicted 724
5 SASI_Hs02_00335549 predicted 697
6 SASI_Hs02_00335550 predicted 241
7 SASI_Hs01_00164327 predicted 618
8 SASI_Hs02_00335551 predicted 300
9 SASI_Hs01_00164335 predicted 301
10 SASI_Hs02_00335552 predicted 939
11 SASI_Hs01_00164329 predicted 1036
12 SASI_Hs01_00164330 predicted 1221
13 SASI_Hs01_00164331 predicted 1032
14 SASI_Hs01_00164332 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067340 predicted 776
2 SASI_Rn01_00067341 predicted 738
3 SASI_Rn01_00067342 predicted 1415
4 SASI_Rn01_00067343 predicted 504
5 SASI_Rn01_00067344 predicted 417
6 SASI_Rn01_00067345 predicted 383
7 SASI_Rn01_00067346 predicted 403
8 SASI_Rn01_00067348 predicted 724
9 SASI_Rn02_00261607 predicted 597
10 SASI_Rn01_00067349 predicted 1418
11 SASI_Rn01_00067347 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138319 predicted 454
2 SASI_Mm01_00138320 predicted 525
3 SASI_Mm01_00138322 predicted 710
4 SASI_Mm01_00138323 predicted 474
5 SASI_Mm01_00138325 predicted 448
6 SASI_Mm01_00138326 predicted 805
7 SASI_Mm01_00138327 predicted 951
8 SASI_Mm01_00138328 predicted 995
9 SASI_Mm02_00316302 predicted 1355
10 SASI_Mm02_00316303 predicted 946
11 SASI_Mm01_00138321 predicted 1298
12 SASI_Mm01_00138324 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003382
VIPR2 MISSION shRNA Bacterial Glycerol Stock
vasoactive intestinal peptide receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003382.4-1677s21c1
Sequence:CCGGGTTGTCATTGACTCGATTTAACTCGAGTTAAATCGAGTCAATGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003382.4-607s21c1
Sequence:CCGGCTTGCAACAGGAAGCATAATTCTCGAGAATTATGCTTCCTGTTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003382.4-991s21c1
Sequence:CCGGACCGGTTGCTGGGATACAAACCTCGAGGTTTGTATCCCAGCAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-1029s1c1
Sequence:CCGGGTGGGTCATACGAATACCGATCTCGAGATCGGTATTCGTATGACCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-259s1c1
Sequence:CCGGTGCCGATTTCATCTGGAAATACTCGAGTATTTCCAGATGAAATCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-1137s1c1
Sequence:CCGGCAACGACCAGTCTCAGTACAACTCGAGTTGTACTGAGACTGGTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-532s1c1
Sequence:CCGGGATGAGAGCAAGATCACGTTTCTCGAGAAACGTGATCTTGCTCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003382.3-1674s1c1
Sequence:CCGGCGTGTTGTCATTGACTCGATTCTCGAGAATCGAGTCAATGACAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003382
VIPR2 MISSION shRNA shRNA Plasmid DNA
vasoactive intestinal peptide receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003382.4-1677s21c1
Sequence:CCGGGTTGTCATTGACTCGATTTAACTCGAGTTAAATCGAGTCAATGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003382.4-607s21c1
Sequence:CCGGCTTGCAACAGGAAGCATAATTCTCGAGAATTATGCTTCCTGTTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003382.4-991s21c1
Sequence:CCGGACCGGTTGCTGGGATACAAACCTCGAGGTTTGTATCCCAGCAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-1029s1c1
Sequence:CCGGGTGGGTCATACGAATACCGATCTCGAGATCGGTATTCGTATGACCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-259s1c1
Sequence:CCGGTGCCGATTTCATCTGGAAATACTCGAGTATTTCCAGATGAAATCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-1137s1c1
Sequence:CCGGCAACGACCAGTCTCAGTACAACTCGAGTTGTACTGAGACTGGTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-532s1c1
Sequence:CCGGGATGAGAGCAAGATCACGTTTCTCGAGAAACGTGATCTTGCTCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003382.3-1674s1c1
Sequence:CCGGCGTGTTGTCATTGACTCGATTCTCGAGAATCGAGTCAATGACAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003382
VIPR2 MISSION shRNA Lentiviral Transduction Particles
vasoactive intestinal peptide receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003382.4-1677s21c1
Sequence:CCGGGTTGTCATTGACTCGATTTAACTCGAGTTAAATCGAGTCAATGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003382.4-607s21c1
Sequence:CCGGCTTGCAACAGGAAGCATAATTCTCGAGAATTATGCTTCCTGTTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003382.4-991s21c1
Sequence:CCGGACCGGTTGCTGGGATACAAACCTCGAGGTTTGTATCCCAGCAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-1029s1c1
Sequence:CCGGGTGGGTCATACGAATACCGATCTCGAGATCGGTATTCGTATGACCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-259s1c1
Sequence:CCGGTGCCGATTTCATCTGGAAATACTCGAGTATTTCCAGATGAAATCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-1137s1c1
Sequence:CCGGCAACGACCAGTCTCAGTACAACTCGAGTTGTACTGAGACTGGTCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003382.3-532s1c1
Sequence:CCGGGATGAGAGCAAGATCACGTTTCTCGAGAAACGTGATCTTGCTCTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003382.3-1674s1c1
Sequence:CCGGCGTGTTGTCATTGACTCGATTCTCGAGAATCGAGTCAATGACAACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009511
VIPR2 MISSION shRNA Bacterial Glycerol Stock
vasoactive intestinal peptide receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-125s1c1
Sequence:CCGGCGCTTTCATCTAGAAATACAACTCGAGTTGTATTTCTAGATGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-939s1c1
Sequence:CCGGCCCTCTTCATCAGCATTGTAACTCGAGTTACAATGCTGATGAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-1086s1c1
Sequence:CCGGCCTTCCCTATTGGCATCTCATCTCGAGATGAGATGCCAATAGGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-1153s1c1
Sequence:CCGGCCTGGTGGTAGCAGTTCTATACTCGAGTATAGAACTGCTACCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-1342s1c1
Sequence:CCGGGCAGTCAGAGACTTCAGTCATCTCGAGATGACTGAAGTCTCTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009511
VIPR2 MISSION shRNA shRNA Plasmid DNA
vasoactive intestinal peptide receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-125s1c1
Sequence:CCGGCGCTTTCATCTAGAAATACAACTCGAGTTGTATTTCTAGATGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-939s1c1
Sequence:CCGGCCCTCTTCATCAGCATTGTAACTCGAGTTACAATGCTGATGAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-1086s1c1
Sequence:CCGGCCTTCCCTATTGGCATCTCATCTCGAGATGAGATGCCAATAGGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-1153s1c1
Sequence:CCGGCCTGGTGGTAGCAGTTCTATACTCGAGTATAGAACTGCTACCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-1342s1c1
Sequence:CCGGGCAGTCAGAGACTTCAGTCATCTCGAGATGACTGAAGTCTCTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009511
VIPR2 MISSION shRNA Lentiviral Transduction Particles
vasoactive intestinal peptide receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-125s1c1
Sequence:CCGGCGCTTTCATCTAGAAATACAACTCGAGTTGTATTTCTAGATGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-939s1c1
Sequence:CCGGCCCTCTTCATCAGCATTGTAACTCGAGTTACAATGCTGATGAAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-1086s1c1
Sequence:CCGGCCTTCCCTATTGGCATCTCATCTCGAGATGAGATGCCAATAGGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-1153s1c1
Sequence:CCGGCCTGGTGGTAGCAGTTCTATACTCGAGTATAGAACTGCTACCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009511.1-1342s1c1
Sequence:CCGGGCAGTCAGAGACTTCAGTCATCTCGAGATGACTGAAGTCTCTGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks