EMAIL THIS PAGE TO A FRIEND
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053276 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103111 MISSION® esiRNA esiRNA human VIT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053276 Rosetta Predictions human pricing
XM_001064219 Rosetta Predictions rat pricing
XM_233802 Rosetta Predictions rat pricing
NM_028813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096914 predicted 452
2 SASI_Hs01_00096915 predicted 609
3 SASI_Hs01_00096916 predicted 1744
4 SASI_Hs01_00096918 predicted 1272
5 SASI_Hs01_00096919 predicted 1303
6 SASI_Hs01_00096920 predicted 716
7 SASI_Hs01_00096921 predicted 661
8 SASI_Hs01_00096922 predicted 545
9 SASI_Hs01_00096923 predicted 1809
10 SASI_Hs02_00361909 predicted 1282
11 SASI_Hs01_00096917 predicted 1831
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309707 predicted 1112
2 SASI_Rn02_00309708 predicted 1889
3 SASI_Rn02_00309709 predicted 1129
4 SASI_Rn02_00309710 predicted 2112
5 SASI_Rn02_00309711 predicted 504
6 SASI_Rn02_00309712 predicted 2055
7 SASI_Rn02_00309713 predicted 625
8 SASI_Rn02_00309714 predicted 635
9 SASI_Rn02_00309715 predicted 870
10 SASI_Rn02_00309716 predicted 2076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388050 predicted 442
2 SASI_Rn02_00388051 predicted 1141
3 SASI_Rn02_00388052 predicted 963
4 SASI_Rn02_00388053 predicted 1130
5 SASI_Rn02_00388054 predicted 545
6 SASI_Rn02_00388055 predicted 629
7 SASI_Rn02_00388056 predicted 633
8 SASI_Rn02_00388057 predicted 884
9 SASI_Rn02_00388058 predicted 552
10 SASI_Rn02_00388059 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027117 predicted 563
2 SASI_Mm01_00027118 predicted 1108
3 SASI_Mm01_00027119 predicted 221
4 SASI_Mm01_00027120 predicted 1129
5 SASI_Mm01_00027121 predicted 1883
6 SASI_Mm01_00027122 predicted 486
7 SASI_Mm01_00027123 predicted 910
8 SASI_Mm01_00027124 predicted 481
9 SASI_Mm01_00027125 predicted 1754
10 SASI_Mm01_00027126 predicted 701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053276
VIT MISSION shRNA Bacterial Glycerol Stock
vitrin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-2225s1c1
Sequence:CCGGGTTTGACAACCTCCATCAGTACTCGAGTACTGATGGAGGTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-2045s1c1
Sequence:CCGGGAGGAAGTTAATGATCCTCATCTCGAGATGAGGATCATTAACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-551s1c1
Sequence:CCGGGTCTGGTTACAAAGGGAGTTACTCGAGTAACTCCCTTTGTAACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053276.2-2324s1c1
Sequence:CCGGCAGCAAGTGCTGCTTTACTAACTCGAGTTAGTAAAGCAGCACTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-623s1c1
Sequence:CCGGCGTCTTAGAAAGTAAACCCAACTCGAGTTGGGTTTACTTTCTAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-2036s1c1
Sequence:CCGGGCCCAACAAGAGGAAGTTAATCTCGAGATTAACTTCCTCTTGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053276.2-1519s21c1
Sequence:CCGGGAGAGTCAGGAATCAACATTTCTCGAGAAATGTTGATTCCTGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053276.2-724s21c1
Sequence:CCGGCCTATCAGAGGCCACCTATTCCTCGAGGAATAGGTGGCCTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053276.2-575s21c1
Sequence:CCGGCAACGGTGTCCAATCGTTATCCTCGAGGATAACGATTGGACACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053276
VIT MISSION shRNA shRNA Plasmid DNA
vitrin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-2225s1c1
Sequence:CCGGGTTTGACAACCTCCATCAGTACTCGAGTACTGATGGAGGTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-2045s1c1
Sequence:CCGGGAGGAAGTTAATGATCCTCATCTCGAGATGAGGATCATTAACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-551s1c1
Sequence:CCGGGTCTGGTTACAAAGGGAGTTACTCGAGTAACTCCCTTTGTAACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053276.2-2324s1c1
Sequence:CCGGCAGCAAGTGCTGCTTTACTAACTCGAGTTAGTAAAGCAGCACTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-623s1c1
Sequence:CCGGCGTCTTAGAAAGTAAACCCAACTCGAGTTGGGTTTACTTTCTAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-2036s1c1
Sequence:CCGGGCCCAACAAGAGGAAGTTAATCTCGAGATTAACTTCCTCTTGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053276.2-1519s21c1
Sequence:CCGGGAGAGTCAGGAATCAACATTTCTCGAGAAATGTTGATTCCTGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053276.2-724s21c1
Sequence:CCGGCCTATCAGAGGCCACCTATTCCTCGAGGAATAGGTGGCCTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053276.2-575s21c1
Sequence:CCGGCAACGGTGTCCAATCGTTATCCTCGAGGATAACGATTGGACACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053276
VIT MISSION shRNA Lentiviral Transduction Particles
vitrin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-2225s1c1
Sequence:CCGGGTTTGACAACCTCCATCAGTACTCGAGTACTGATGGAGGTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-2045s1c1
Sequence:CCGGGAGGAAGTTAATGATCCTCATCTCGAGATGAGGATCATTAACTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-551s1c1
Sequence:CCGGGTCTGGTTACAAAGGGAGTTACTCGAGTAACTCCCTTTGTAACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135338    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053276.2-2324s1c1
Sequence:CCGGCAGCAAGTGCTGCTTTACTAACTCGAGTTAGTAAAGCAGCACTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-623s1c1
Sequence:CCGGCGTCTTAGAAAGTAAACCCAACTCGAGTTGGGTTTACTTTCTAAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053276.2-2036s1c1
Sequence:CCGGGCCCAACAAGAGGAAGTTAATCTCGAGATTAACTTCCTCTTGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053276.2-1519s21c1
Sequence:CCGGGAGAGTCAGGAATCAACATTTCTCGAGAAATGTTGATTCCTGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053276.2-724s21c1
Sequence:CCGGCCTATCAGAGGCCACCTATTCCTCGAGGAATAGGTGGCCTCTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053276.2-575s21c1
Sequence:CCGGCAACGGTGTCCAATCGTTATCCTCGAGGATAACGATTGGACACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028813
VIT MISSION shRNA Bacterial Glycerol Stock
vitrin
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028813.1-795s1c1
Sequence:CCGGCAGATCCACCTCAAAGCCATTCTCGAGAATGGCTTTGAGGTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028813.1-1587s1c1
Sequence:CCGGCTGTTTAAACTCTGCGGACATCTCGAGATGTCCGCAGAGTTTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028813.1-2283s1c1
Sequence:CCGGCGTTTGGTGTTACTATTCTTTCTCGAGAAAGAATAGTAACACCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028813.1-486s1c1
Sequence:CCGGGCTGGATAATTCAGGAGGGAACTCGAGTTCCCTCCTGAATTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028813
VIT MISSION shRNA shRNA Plasmid DNA
vitrin
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028813.1-795s1c1
Sequence:CCGGCAGATCCACCTCAAAGCCATTCTCGAGAATGGCTTTGAGGTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028813.1-1587s1c1
Sequence:CCGGCTGTTTAAACTCTGCGGACATCTCGAGATGTCCGCAGAGTTTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028813.1-2283s1c1
Sequence:CCGGCGTTTGGTGTTACTATTCTTTCTCGAGAAAGAATAGTAACACCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028813.1-486s1c1
Sequence:CCGGGCTGGATAATTCAGGAGGGAACTCGAGTTCCCTCCTGAATTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028813
VIT MISSION shRNA Lentiviral Transduction Particles
vitrin
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028813.1-795s1c1
Sequence:CCGGCAGATCCACCTCAAAGCCATTCTCGAGAATGGCTTTGAGGTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028813.1-1587s1c1
Sequence:CCGGCTGTTTAAACTCTGCGGACATCTCGAGATGTCCGCAGAGTTTAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028813.1-2283s1c1
Sequence:CCGGCGTTTGGTGTTACTATTCTTTCTCGAGAAAGAATAGTAACACCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028813.1-486s1c1
Sequence:CCGGGCTGGATAATTCAGGAGGGAACTCGAGTTCCCTCCTGAATTATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks