EMAIL THIS PAGE TO A FRIEND

VKORC1

vitamin K epoxide reductase complex, subunit 1

Synonyms: EDTP308 IMAGE3455200 MST134 MST576 VKCFD2 VKOR
UniProtKB ID: Q9BQB6, A6NIQ6, B2R4Z6, Q6UX90, Q7Z2R4
Gene ID:
Human(79001) Summary: Vitamin K is essential for blood clotting but must be enzymatically activated. This enzymatically activated form of vitamin K is a reduced form required for the carboxylation of glutamic acid residues in some blood-clotting proteins. The product of this gene encodes the enzyme that is responsible for reducing vitamin K 2,3-epoxide to the enzymatically activated form. Fatal bleeding can be caused by vitamin K deficiency and by the vitamin K antagonist warfarin, and it is the product of this gene that is sensitive to warfarin. In humans, mutations in this gene can be associated with deficiencies in vitamin-K-dependent clotting factors and, in humans and rats, with warfarin resistance. Two pseudogenes have been identified on chromosome 1 and the X chromosome. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(27973) vitamin K epoxide reductase complex, subunit 1
Rat(309004) vitamin K epoxide reductase complex, subunit 1
Zebrafish(100000559) vitamin K epoxide reductase complex, subunit 1
dog(479775) vitamin K epoxide reductase complex, subunit 1
domestic cat(101089669) vitamin K epoxide reductase complex, subunit 1
chicken(404205) vitamin K epoxide reductase complex, subunit 1
naked mole-rat(101712530) vitamin K epoxide reductase complex, subunit 1
domestic guinea pig(100717597) vitamin K epoxide reductase complex, subunit 1
cow(445422) vitamin K epoxide reductase complex, subunit 1
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_206824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024006 Rosetta Predictions human pricing
NM_206824 Rosetta Predictions human pricing
NM_203335 Rosetta Predictions rat pricing
NM_178600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233044 predicted 734
2 SASI_Hs01_00233046 predicted 751
3 SASI_Hs01_00233047 predicted 729
4 SASI_Hs01_00233048 predicted 747
5 SASI_Hs01_00233049 predicted 727
6 SASI_Hs01_00233051 predicted 727
7 SASI_Hs01_00233052 predicted 742
8 SASI_Hs01_00233053 predicted 711
9 SASI_Hs02_00356423 predicted 707
10 SASI_Hs02_00356424 predicted 736
11 SASI_Hs01_00233045 predicted 737
12 SASI_Hs01_00233050 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184642 predicted 624
2 SASI_Hs01_00184644 predicted 650
3 SASI_Hs01_00184645 predicted 616
4 SASI_Hs01_00184646 predicted 632
5 SASI_Hs01_00184647 predicted 615
6 SASI_Hs01_00184649 predicted 613
7 SASI_Hs01_00184650 predicted 625
8 SASI_Hs01_00184651 predicted 595
9 SASI_Hs02_00373545 predicted 624
10 SASI_Hs02_00373546 predicted 622
11 SASI_Hs01_00184643 predicted 620
12 SASI_Hs01_00184648 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060992 predicted 253
2 SASI_Rn01_00060993 predicted 433
3 SASI_Rn01_00060994 predicted 286
4 SASI_Rn01_00060995 predicted 381
5 SASI_Rn01_00060996 predicted 239
6 SASI_Rn01_00060997 predicted 475
7 SASI_Rn01_00060998 predicted 317
8 SASI_Rn01_00060999 predicted 381
9 SASI_Rn01_00061000 predicted 508
10 SASI_Rn02_00270355 predicted 243
11 SASI_Rn01_00061001 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059468 predicted 522
2 SASI_Mm01_00059469 predicted 271
3 SASI_Mm01_00059470 predicted 433
4 SASI_Mm02_00348939 predicted 518
5 SASI_Mm01_00059471 predicted 263
6 SASI_Mm01_00059472 predicted 462
7 SASI_Mm01_00059473 predicted 454
8 SASI_Mm01_00059474 predicted 254
9 SASI_Mm01_00059475 predicted 260
10 SASI_Mm01_00059476 predicted 380
11 SASI_Mm01_00059477 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178600
VALIDATED
VKORC1 MISSION shRNA Bacterial Glycerol Stock
vitamin K epoxide reductase complex, subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-493s21c3
Sequence:CCGGGTACCAGAACACAAGACCAAACTCGAGTTTGGTCTTGTGTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-438s21c3
Sequence:CCGGGTGCATTACCACCTATGCCATCTCGAGATGGCATAGGTGGTAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-276s21c2
Sequence:CCGGCAGCATATTTGGTTGCCTGTTCTCGAGAACAGGCAACCAAATATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-400s21c2
Sequence:CCGGTGGATCCTGTTCTTTGTGTTACTCGAGTAACACAAAGAACAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-261s21c2
Sequence:CCGGCCTCAACCAATCCAACAGCATCTCGAGATGCTGTTGGATTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-493s1c1
Sequence:CCGGGTACCAGAACACAAGACCAAACTCGAGTTTGGTCTTGTGTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178600.2-261s1c1
Sequence:CCGGCCTCAACCAATCCAACAGCATCTCGAGATGCTGTTGGATTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-400s1c1
Sequence:CCGGTGGATCCTGTTCTTTGTGTTACTCGAGTAACACAAAGAACAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-276s1c1
Sequence:CCGGCAGCATATTTGGTTGCCTGTTCTCGAGAACAGGCAACCAAATATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-438s1c1
Sequence:CCGGGTGCATTACCACCTATGCCATCTCGAGATGGCATAGGTGGTAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178600
VALIDATED
VKORC1 MISSION shRNA shRNA Plasmid DNA
vitamin K epoxide reductase complex, subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-493s21c3
Sequence:CCGGGTACCAGAACACAAGACCAAACTCGAGTTTGGTCTTGTGTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-438s21c3
Sequence:CCGGGTGCATTACCACCTATGCCATCTCGAGATGGCATAGGTGGTAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-276s21c2
Sequence:CCGGCAGCATATTTGGTTGCCTGTTCTCGAGAACAGGCAACCAAATATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-400s21c2
Sequence:CCGGTGGATCCTGTTCTTTGTGTTACTCGAGTAACACAAAGAACAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-261s21c2
Sequence:CCGGCCTCAACCAATCCAACAGCATCTCGAGATGCTGTTGGATTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-493s1c1
Sequence:CCGGGTACCAGAACACAAGACCAAACTCGAGTTTGGTCTTGTGTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178600.2-261s1c1
Sequence:CCGGCCTCAACCAATCCAACAGCATCTCGAGATGCTGTTGGATTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-400s1c1
Sequence:CCGGTGGATCCTGTTCTTTGTGTTACTCGAGTAACACAAAGAACAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-276s1c1
Sequence:CCGGCAGCATATTTGGTTGCCTGTTCTCGAGAACAGGCAACCAAATATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-438s1c1
Sequence:CCGGGTGCATTACCACCTATGCCATCTCGAGATGGCATAGGTGGTAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178600
VALIDATED
VKORC1 MISSION shRNA Lentiviral Transduction Particles
vitamin K epoxide reductase complex, subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-493s21c3
Sequence:CCGGGTACCAGAACACAAGACCAAACTCGAGTTTGGTCTTGTGTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-438s21c3
Sequence:CCGGGTGCATTACCACCTATGCCATCTCGAGATGGCATAGGTGGTAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-276s21c2
Sequence:CCGGCAGCATATTTGGTTGCCTGTTCTCGAGAACAGGCAACCAAATATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-400s21c2
Sequence:CCGGTGGATCCTGTTCTTTGTGTTACTCGAGTAACACAAAGAACAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178600.2-261s21c2
Sequence:CCGGCCTCAACCAATCCAACAGCATCTCGAGATGCTGTTGGATTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-493s1c1
Sequence:CCGGGTACCAGAACACAAGACCAAACTCGAGTTTGGTCTTGTGTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_178600.2-261s1c1
Sequence:CCGGCCTCAACCAATCCAACAGCATCTCGAGATGCTGTTGGATTGGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-400s1c1
Sequence:CCGGTGGATCCTGTTCTTTGTGTTACTCGAGTAACACAAAGAACAGGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-276s1c1
Sequence:CCGGCAGCATATTTGGTTGCCTGTTCTCGAGAACAGGCAACCAAATATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178600.2-438s1c1
Sequence:CCGGGTGCATTACCACCTATGCCATCTCGAGATGGCATAGGTGGTAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206824
VALIDATED
VKORC1 MISSION shRNA Bacterial Glycerol Stock
vitamin K epoxide reductase complex, subunit 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-266s21c1
Sequence:CCGGGCTCTTTGCCTGACGGGCTTACTCGAGTAAGCCCGTCAGGCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-479s21c1
Sequence:CCGGCTGGATCCTGTTCTTCGTGCTCTCGAGAGCACGAAGAACAGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-445s21c1
Sequence:CCGGCCCTGGTGTCTCTCGCTGGTTCTCGAGAACCAGCGAGAGACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-289s21c1
Sequence:CCGGGCTCTCGCTCTACGCGCTGCACTCGAGTGCAGCGCGTAGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-289s1c1
Sequence:CCGGGCTCTCGCTCTACGCGCTGCACTCGAGTGCAGCGCGTAGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-445s1c1
Sequence:CCGGCCCTGGTGTCTCTCGCTGGTTCTCGAGAACCAGCGAGAGACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-266s1c1
Sequence:CCGGGCTCTTTGCCTGACGGGCTTACTCGAGTAAGCCCGTCAGGCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-479s1c1
Sequence:CCGGCTGGATCCTGTTCTTCGTGCTCTCGAGAGCACGAAGAACAGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206824.1-393s1c1
Sequence:CCGGCCTCCAGGTTGCCTGCGGACACTCGAGTGTCCGCAGGCAACCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206824
VALIDATED
VKORC1 MISSION shRNA shRNA Plasmid DNA
vitamin K epoxide reductase complex, subunit 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-266s21c1
Sequence:CCGGGCTCTTTGCCTGACGGGCTTACTCGAGTAAGCCCGTCAGGCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-479s21c1
Sequence:CCGGCTGGATCCTGTTCTTCGTGCTCTCGAGAGCACGAAGAACAGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-445s21c1
Sequence:CCGGCCCTGGTGTCTCTCGCTGGTTCTCGAGAACCAGCGAGAGACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-289s21c1
Sequence:CCGGGCTCTCGCTCTACGCGCTGCACTCGAGTGCAGCGCGTAGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-289s1c1
Sequence:CCGGGCTCTCGCTCTACGCGCTGCACTCGAGTGCAGCGCGTAGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-445s1c1
Sequence:CCGGCCCTGGTGTCTCTCGCTGGTTCTCGAGAACCAGCGAGAGACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-266s1c1
Sequence:CCGGGCTCTTTGCCTGACGGGCTTACTCGAGTAAGCCCGTCAGGCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-479s1c1
Sequence:CCGGCTGGATCCTGTTCTTCGTGCTCTCGAGAGCACGAAGAACAGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206824.1-393s1c1
Sequence:CCGGCCTCCAGGTTGCCTGCGGACACTCGAGTGTCCGCAGGCAACCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206824
VALIDATED
VKORC1 MISSION shRNA Lentiviral Transduction Particles
vitamin K epoxide reductase complex, subunit 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-266s21c1
Sequence:CCGGGCTCTTTGCCTGACGGGCTTACTCGAGTAAGCCCGTCAGGCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-479s21c1
Sequence:CCGGCTGGATCCTGTTCTTCGTGCTCTCGAGAGCACGAAGAACAGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-445s21c1
Sequence:CCGGCCCTGGTGTCTCTCGCTGGTTCTCGAGAACCAGCGAGAGACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_206824.1-289s21c1
Sequence:CCGGGCTCTCGCTCTACGCGCTGCACTCGAGTGCAGCGCGTAGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-289s1c1
Sequence:CCGGGCTCTCGCTCTACGCGCTGCACTCGAGTGCAGCGCGTAGAGCGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-445s1c1
Sequence:CCGGCCCTGGTGTCTCTCGCTGGTTCTCGAGAACCAGCGAGAGACACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-266s1c1
Sequence:CCGGGCTCTTTGCCTGACGGGCTTACTCGAGTAAGCCCGTCAGGCAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_206824.1-479s1c1
Sequence:CCGGCTGGATCCTGTTCTTCGTGCTCTCGAGAGCACGAAGAACAGGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206824.1-393s1c1
Sequence:CCGGCCTCCAGGTTGCCTGCGGACACTCGAGTGTCCGCAGGCAACCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks