EMAIL THIS PAGE TO A FRIEND

VKORC1L1

vitamin K epoxide reductase complex, subunit 1-like 1

UniProtKB ID: Q8N0U8, Q6AHW9, Q6TEK6
Gene ID:
Mouse(69568) vitamin K epoxide reductase complex, subunit 1-like 1
Rat(399684) vitamin K epoxide reductase complex, subunit 1-like 1
cow(506318) vitamin K epoxide reductase complex, subunit 1-like 1
sheep(101108541) vitamin K epoxide reductase complex, subunit 1-like 1
domestic guinea pig(100720684) vitamin K epoxide reductase complex, subunit 1-like 1
naked mole-rat(101708956) vitamin K epoxide reductase complex, subunit 1-like 1
Zebrafish(553717) vitamin K epoxide reductase complex, subunit 1-like 1
domestic cat(101085010) vitamin K epoxide reductase complex, subunit 1-like 1
dog(606915) vitamin K epoxide reductase complex, subunit 1-like 1
chicken(408253) vitamin K epoxide reductase complex, subunit 1-like 1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173517 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173517 Rosetta Predictions human pricing
NM_203338 Rosetta Predictions rat pricing
NM_001001327 Rosetta Predictions mouse pricing
NM_027121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089790 predicted 394
2 SASI_Hs01_00089791 predicted 435
3 SASI_Hs01_00089793 predicted 422
4 SASI_Hs01_00089794 predicted 415
5 SASI_Hs01_00089795 predicted 406
6 SASI_Hs01_00089797 predicted 417
7 SASI_Hs01_00089798 predicted 430
8 SASI_Hs01_00089799 predicted 410
9 SASI_Hs02_00368296 predicted 466
10 SASI_Hs02_00368297 predicted 361
11 SASI_Hs01_00089792 predicted 333
12 SASI_Hs01_00089796 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051104 predicted 365
2 SASI_Rn01_00051105 predicted 302
3 SASI_Rn01_00051106 predicted 338
4 SASI_Rn01_00051107 predicted 303
5 SASI_Rn01_00051108 predicted 298
6 SASI_Rn01_00051109 predicted 289
7 SASI_Rn01_00051110 predicted 338
8 SASI_Rn01_00051112 predicted 363
9 SASI_Rn02_00270360 predicted 308
10 SASI_Rn01_00051113 predicted 335
11 SASI_Rn01_00051111 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139238 predicted 782
2 SASI_Mm01_00139239 predicted 776
3 SASI_Mm01_00139237 predicted 772
4 SASI_Mm01_00139240 predicted 776
5 SASI_Mm01_00139244 predicted 787
6 SASI_Mm01_00139246 predicted 508
7 SASI_Mm02_00286128 predicted 702
8 SASI_Mm01_00139241 predicted 938
9 SASI_Mm02_00286129 predicted 331
10 SASI_Mm01_00139242 predicted 684
11 SASI_Mm01_00139243 predicted 693
12 SASI_Mm01_00139245 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031714 predicted 891
2 SASI_Mm01_00031715 predicted 889
3 SASI_Mm01_00031713 predicted 885
4 SASI_Mm01_00031716 predicted 884
5 SASI_Mm01_00031720 predicted 906
6 SASI_Mm01_00031722 predicted 812
7 SASI_Mm01_00031717 predicted 1053
8 SASI_Mm02_00331586 predicted 836
9 SASI_Mm02_00331587 predicted 352
10 SASI_Mm02_00331588 predicted 439
11 SASI_Mm01_00031718 predicted 797
12 SASI_Mm01_00031719 predicted 803
13 SASI_Mm01_00031721 predicted 1003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173517
VKORC1L1 MISSION shRNA Bacterial Glycerol Stock
vitamin K epoxide reductase complex, subunit 1-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-378s1c1
Sequence:CCGGCCTGGCCTACATTCTGTACTTCTCGAGAAGTACAGAATGTAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-240s1c1
Sequence:CCGGTGGTGTATTAAACCAGCCAAACTCGAGTTTGGCTGGTTTAATACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-260s1c1
Sequence:CCGGACAGTGTCTTTGGACTTATATCTCGAGATATAAGTCCAAAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-84s1c1
Sequence:CCGGGCTCTCCATCTACGCCTACCACTCGAGTGGTAGGCGTAGATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-256s1c1
Sequence:CCGGCCAAACAGTGTCTTTGGACTTCTCGAGAAGTCCAAAGACACTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173517.3-586s21c1
Sequence:CCGGTACTTGAACGAGGCCTGGAAGCTCGAGCTTCCAGGCCTCGTTCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173517.3-852s21c1
Sequence:CCGGCAATCAAAGACAAGCTTTAACCTCGAGGTTAAAGCTTGTCTTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173517.3-939s21c1
Sequence:CCGGAGCAACCATTGCTAGTAATTCCTCGAGGAATTACTAGCAATGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173517.3-926s21c1
Sequence:CCGGCAATTGTAAAGTGAGCAACCACTCGAGTGGTTGCTCACTTTACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173517.3-393s21c1
Sequence:CCGGACAGTTATTACTTGGCATGACCTCGAGGTCATGCCAAGTAATAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173517.3-435s21c1
Sequence:CCGGGATCCTCATGACGTCCTCCATCTCGAGATGGAGGACGTCATGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173517
VKORC1L1 MISSION shRNA shRNA Plasmid DNA
vitamin K epoxide reductase complex, subunit 1-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-378s1c1
Sequence:CCGGCCTGGCCTACATTCTGTACTTCTCGAGAAGTACAGAATGTAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-240s1c1
Sequence:CCGGTGGTGTATTAAACCAGCCAAACTCGAGTTTGGCTGGTTTAATACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-260s1c1
Sequence:CCGGACAGTGTCTTTGGACTTATATCTCGAGATATAAGTCCAAAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-84s1c1
Sequence:CCGGGCTCTCCATCTACGCCTACCACTCGAGTGGTAGGCGTAGATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-256s1c1
Sequence:CCGGCCAAACAGTGTCTTTGGACTTCTCGAGAAGTCCAAAGACACTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173517.3-586s21c1
Sequence:CCGGTACTTGAACGAGGCCTGGAAGCTCGAGCTTCCAGGCCTCGTTCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173517.3-852s21c1
Sequence:CCGGCAATCAAAGACAAGCTTTAACCTCGAGGTTAAAGCTTGTCTTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173517.3-939s21c1
Sequence:CCGGAGCAACCATTGCTAGTAATTCCTCGAGGAATTACTAGCAATGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173517.3-926s21c1
Sequence:CCGGCAATTGTAAAGTGAGCAACCACTCGAGTGGTTGCTCACTTTACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173517.3-393s21c1
Sequence:CCGGACAGTTATTACTTGGCATGACCTCGAGGTCATGCCAAGTAATAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173517.3-435s21c1
Sequence:CCGGGATCCTCATGACGTCCTCCATCTCGAGATGGAGGACGTCATGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173517
VKORC1L1 MISSION shRNA Lentiviral Transduction Particles
vitamin K epoxide reductase complex, subunit 1-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-378s1c1
Sequence:CCGGCCTGGCCTACATTCTGTACTTCTCGAGAAGTACAGAATGTAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-240s1c1
Sequence:CCGGTGGTGTATTAAACCAGCCAAACTCGAGTTTGGCTGGTTTAATACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-260s1c1
Sequence:CCGGACAGTGTCTTTGGACTTATATCTCGAGATATAAGTCCAAAGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-84s1c1
Sequence:CCGGGCTCTCCATCTACGCCTACCACTCGAGTGGTAGGCGTAGATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173517.2-256s1c1
Sequence:CCGGCCAAACAGTGTCTTTGGACTTCTCGAGAAGTCCAAAGACACTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173517.3-586s21c1
Sequence:CCGGTACTTGAACGAGGCCTGGAAGCTCGAGCTTCCAGGCCTCGTTCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173517.3-852s21c1
Sequence:CCGGCAATCAAAGACAAGCTTTAACCTCGAGGTTAAAGCTTGTCTTTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173517.3-939s21c1
Sequence:CCGGAGCAACCATTGCTAGTAATTCCTCGAGGAATTACTAGCAATGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173517.3-926s21c1
Sequence:CCGGCAATTGTAAAGTGAGCAACCACTCGAGTGGTTGCTCACTTTACAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173517.3-393s21c1
Sequence:CCGGACAGTTATTACTTGGCATGACCTCGAGGTCATGCCAAGTAATAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173517.3-435s21c1
Sequence:CCGGGATCCTCATGACGTCCTCCATCTCGAGATGGAGGACGTCATGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001327
VKORC1L1 MISSION shRNA Bacterial Glycerol Stock
vitamin K epoxide reductase complex, subunit 1-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-336s1c1
Sequence:CCGGCATTCTGTACTTTGTGCTGAACTCGAGTTCAGCACAAAGTACAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001327.1-590s1c1
Sequence:CCGGCCTCAGAATCTTAAACTGATTCTCGAGAATCAGTTTAAGATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-403s1c1
Sequence:CCGGCTCCTCATCATCAATTACAAACTCGAGTTTGTAATTGATGATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-140s1c1
Sequence:CCGGCCTGCTCTCCATCTACGCCTACTCGAGTAGGCGTAGATGGAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-375s1c1
Sequence:CCGGCGTCACCACATATGTGCTGAACTCGAGTTCAGCACATATGTGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001327
VKORC1L1 MISSION shRNA shRNA Plasmid DNA
vitamin K epoxide reductase complex, subunit 1-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-336s1c1
Sequence:CCGGCATTCTGTACTTTGTGCTGAACTCGAGTTCAGCACAAAGTACAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001327.1-590s1c1
Sequence:CCGGCCTCAGAATCTTAAACTGATTCTCGAGAATCAGTTTAAGATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-403s1c1
Sequence:CCGGCTCCTCATCATCAATTACAAACTCGAGTTTGTAATTGATGATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-140s1c1
Sequence:CCGGCCTGCTCTCCATCTACGCCTACTCGAGTAGGCGTAGATGGAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-375s1c1
Sequence:CCGGCGTCACCACATATGTGCTGAACTCGAGTTCAGCACATATGTGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001327
VKORC1L1 MISSION shRNA Lentiviral Transduction Particles
vitamin K epoxide reductase complex, subunit 1-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-336s1c1
Sequence:CCGGCATTCTGTACTTTGTGCTGAACTCGAGTTCAGCACAAAGTACAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001327.1-590s1c1
Sequence:CCGGCCTCAGAATCTTAAACTGATTCTCGAGAATCAGTTTAAGATTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-403s1c1
Sequence:CCGGCTCCTCATCATCAATTACAAACTCGAGTTTGTAATTGATGATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-140s1c1
Sequence:CCGGCCTGCTCTCCATCTACGCCTACTCGAGTAGGCGTAGATGGAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001327.1-375s1c1
Sequence:CCGGCGTCACCACATATGTGCTGAACTCGAGTTCAGCACATATGTGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks