EMAIL THIS PAGE TO A FRIEND

VLDLR

very low density lipoprotein receptor

Synonyms: CARMQ1 CHRMQ1 VLDLRCH
UniProtKB ID: P98155, B2RMZ7, D3DRH6, Q5VVF6
Gene ID:
Human(7436) Summary: The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
Mouse(22359) very low density lipoprotein receptor
Rat(25696) very low density lipoprotein receptor
Zebrafish(393897) very low density lipoprotein receptor
dog(476336) very low density lipoprotein receptor
Horse(100050907) very low density lipoprotein receptor
domestic cat(101101092) very low density lipoprotein receptor
chicken(396154) very low density lipoprotein receptor
cow(282123) very low density lipoprotein receptor
sheep(101117143) very low density lipoprotein receptor
naked mole-rat(101709214) very low density lipoprotein receptor
Domestic Rabbit(100008976) very low density lipoprotein receptor
domestic guinea pig(100725662) very low density lipoprotein receptor
229 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW20090F Anti-VLDL antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1303099 ANTI-VLDLR (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003383 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013703 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013703 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013703 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018056 Rosetta Predictions human pricing
NM_003383 Rosetta Predictions human pricing
NM_013155 Rosetta Predictions rat pricing
NM_013703 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306944 predicted 1950
2 SASI_Hs01_00038443 predicted 1781
3 SASI_Hs01_00038444 predicted 2950
4 SASI_Hs01_00038445 predicted 715
5 SASI_Hs01_00038446 predicted 2046
6 SASI_Hs01_00038447 predicted 2205
7 SASI_Hs01_00038448 predicted 1719
8 SASI_Hs01_00038449 predicted 1507
9 SASI_Hs01_00038450 predicted 1642
10 SASI_Hs01_00038452 predicted 1202
11 SASI_Hs01_00038451 predicted 1804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335553 predicted 1943
2 SASI_Hs01_00219062 predicted 1778
3 SASI_Hs01_00219063 predicted 3029
4 SASI_Hs01_00219064 predicted 713
5 SASI_Hs01_00219065 predicted 2039
6 SASI_Hs01_00219066 predicted 2204
7 SASI_Hs01_00219067 predicted 1717
8 SASI_Hs01_00219068 predicted 1510
9 SASI_Hs01_00219069 predicted 1637
10 SASI_Hs01_00219071 predicted 1200
11 SASI_Hs01_00219070 predicted 1800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260965 predicted 2630
2 SASI_Rn02_00260966 predicted 2107
3 SASI_Rn01_00059446 predicted 1816
4 SASI_Rn01_00059447 predicted 883
5 SASI_Rn02_00260967 predicted 384
6 SASI_Rn01_00059448 predicted 2177
7 SASI_Rn01_00059450 predicted 1992
8 SASI_Rn01_00059451 predicted 332
9 SASI_Rn01_00059452 predicted 2478
10 SASI_Rn01_00059453 predicted 1027
11 SASI_Rn01_00059444 predicted 511
12 SASI_Rn01_00059445 predicted 1512
13 SASI_Rn01_00059449 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063216 predicted 1503
2 SASI_Mm01_00063217 predicted 2634
3 SASI_Mm01_00063218 predicted 1827
4 SASI_Mm01_00063219 predicted 2104
5 SASI_Mm01_00063220 predicted 1251
6 SASI_Mm02_00322606 predicted 1566
7 SASI_Mm01_00063222 predicted 1550
8 SASI_Mm01_00063224 predicted 2483
9 SASI_Mm02_00322607 predicted 986
10 SASI_Mm02_00322608 predicted 2697
11 SASI_Mm01_00063215 predicted 1300
12 SASI_Mm01_00063221 predicted 2357
13 SASI_Mm01_00063223 predicted 1997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003383
VALIDATED
VLDLR MISSION shRNA Bacterial Glycerol Stock
very low density lipoprotein receptor
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003383.3-3034s21c1
Sequence:CCGGGTTGACCTTTGAGGTCTAAACCTCGAGGTTTAGACCTCAAAGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003383.3-1919s21c1
Sequence:CCGGATGATCGACAATGTCTATAATCTCGAGATTATAGACATTGTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003383.3-1504s21c1
Sequence:CCGGTATCTGCAAAGACCTAGTTATCTCGAGATAACTAGGTCTTTGCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003383.3-2293s21c1
Sequence:CCGGAGATCGTAGGATAGTACTAAACTCGAGTTTAGTACTATCCTACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003383.3-2194s21c1
Sequence:CCGGCCAGTGGCCTAACGGAATTACCTCGAGGTAATTCCGTTAGGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003383.3-2333s21c1
Sequence:CCGGCATCCTCTTGCACTAACAATACTCGAGTATTGTTAGTGCAAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003383.2-1658s1c1
Sequence:CCGGCGTGCCTATCAAATGGATCTTCTCGAGAAGATCCATTTGATAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003383.2-2239s1c1
Sequence:CCGGGCTTGATTCTAAGTTGCACATCTCGAGATGTGCAACTTAGAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003383.2-1444s1c1
Sequence:CCGGCCTGAAAGAGTGTCATATAAACTCGAGTTTATATGACACTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003383.2-754s1c1
Sequence:CCGGCGCCCATTCTACTCAGTGTATCTCGAGATACACTGAGTAGAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003383.2-2991s1c1
Sequence:CCGGGCACAGATGATGATCTAGCTTCTCGAGAAGCTAGATCATCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003383
VALIDATED
VLDLR MISSION shRNA shRNA Plasmid DNA
very low density lipoprotein receptor
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003383.3-3034s21c1
Sequence:CCGGGTTGACCTTTGAGGTCTAAACCTCGAGGTTTAGACCTCAAAGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003383.3-1919s21c1
Sequence:CCGGATGATCGACAATGTCTATAATCTCGAGATTATAGACATTGTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003383.3-1504s21c1
Sequence:CCGGTATCTGCAAAGACCTAGTTATCTCGAGATAACTAGGTCTTTGCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003383.3-2293s21c1
Sequence:CCGGAGATCGTAGGATAGTACTAAACTCGAGTTTAGTACTATCCTACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003383.3-2194s21c1
Sequence:CCGGCCAGTGGCCTAACGGAATTACCTCGAGGTAATTCCGTTAGGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003383.3-2333s21c1
Sequence:CCGGCATCCTCTTGCACTAACAATACTCGAGTATTGTTAGTGCAAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003383.2-1658s1c1
Sequence:CCGGCGTGCCTATCAAATGGATCTTCTCGAGAAGATCCATTTGATAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003383.2-2239s1c1
Sequence:CCGGGCTTGATTCTAAGTTGCACATCTCGAGATGTGCAACTTAGAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003383.2-1444s1c1
Sequence:CCGGCCTGAAAGAGTGTCATATAAACTCGAGTTTATATGACACTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003383.2-754s1c1
Sequence:CCGGCGCCCATTCTACTCAGTGTATCTCGAGATACACTGAGTAGAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003383.2-2991s1c1
Sequence:CCGGGCACAGATGATGATCTAGCTTCTCGAGAAGCTAGATCATCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003383
VALIDATED
VLDLR MISSION shRNA Lentiviral Transduction Particles
very low density lipoprotein receptor
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_003383.3-3034s21c1
Sequence:CCGGGTTGACCTTTGAGGTCTAAACCTCGAGGTTTAGACCTCAAAGGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003383.3-1919s21c1
Sequence:CCGGATGATCGACAATGTCTATAATCTCGAGATTATAGACATTGTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003383.3-1504s21c1
Sequence:CCGGTATCTGCAAAGACCTAGTTATCTCGAGATAACTAGGTCTTTGCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_003383.3-2293s21c1
Sequence:CCGGAGATCGTAGGATAGTACTAAACTCGAGTTTAGTACTATCCTACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003383.3-2194s21c1
Sequence:CCGGCCAGTGGCCTAACGGAATTACCTCGAGGTAATTCCGTTAGGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003383.3-2333s21c1
Sequence:CCGGCATCCTCTTGCACTAACAATACTCGAGTATTGTTAGTGCAAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003383.2-1658s1c1
Sequence:CCGGCGTGCCTATCAAATGGATCTTCTCGAGAAGATCCATTTGATAGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003383.2-2239s1c1
Sequence:CCGGGCTTGATTCTAAGTTGCACATCTCGAGATGTGCAACTTAGAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003383.2-1444s1c1
Sequence:CCGGCCTGAAAGAGTGTCATATAAACTCGAGTTTATATGACACTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003383.2-754s1c1
Sequence:CCGGCGCCCATTCTACTCAGTGTATCTCGAGATACACTGAGTAGAATGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003383.2-2991s1c1
Sequence:CCGGGCACAGATGATGATCTAGCTTCTCGAGAAGCTAGATCATCATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013703
VALIDATED
VLDLR MISSION shRNA Bacterial Glycerol Stock
very low density lipoprotein receptor
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.2-3416s21c1
Sequence:CCGGTGGATGTGGTTACCAAGTATCCTCGAGGATACTTGGTAACCACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013703.2-1702s21c1
Sequence:CCGGTATCTGCAAAGACCTAGTTATCTCGAGATAACTAGGTCTTTGCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013703.1-1502s21c1
Sequence:CCGGCCGAGTCTGATCTTCACTAATCTCGAGATTAGTGAAGATCAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-1252s21c1
Sequence:CCGGCAACGAATGCCTGGTCAATAACTCGAGTTATTGACCAGGCATTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-2935s21c1
Sequence:CCGGAGTTTGAGTACTTGATCATTTCTCGAGAAATGATCAAGTACTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-1774s21c1
Sequence:CCGGTGCGGCTTCTAAGACTATTTCCTCGAGGAAATAGTCTTAGAAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.2-1285s21c1
Sequence:CCGGCCGTCAGCCTGTGATACATACCTCGAGGTATGTATCACAGGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-509s21c1
Sequence:CCGGATGAGAACATGCCGCATAAATCTCGAGATTTATGCGGCATGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013703.1-3094s1c1
Sequence:CCGGCCAGCAATGAACCTTGTGCTACTCGAGTAGCACAAGGTTCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013703.1-426s1c1
Sequence:CCGGGCCAGTGTGTTCCTAACAGATCTCGAGATCTGTTAGGAACACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013703.1-367s1c1
Sequence:CCGGCGACGAGAAGAACTGTGTAAACTCGAGTTTACACAGTTCTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013703.1-1502s1c1
Sequence:CCGGCCGAGTCTGATCTTCACTAATCTCGAGATTAGTGAAGATCAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013703.1-1501s1c1
Sequence:CCGGGCCGAGTCTGATCTTCACTAACTCGAGTTAGTGAAGATCAGACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013703
VALIDATED
VLDLR MISSION shRNA shRNA Plasmid DNA
very low density lipoprotein receptor
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.2-3416s21c1
Sequence:CCGGTGGATGTGGTTACCAAGTATCCTCGAGGATACTTGGTAACCACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013703.2-1702s21c1
Sequence:CCGGTATCTGCAAAGACCTAGTTATCTCGAGATAACTAGGTCTTTGCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013703.1-1502s21c1
Sequence:CCGGCCGAGTCTGATCTTCACTAATCTCGAGATTAGTGAAGATCAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-1252s21c1
Sequence:CCGGCAACGAATGCCTGGTCAATAACTCGAGTTATTGACCAGGCATTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-2935s21c1
Sequence:CCGGAGTTTGAGTACTTGATCATTTCTCGAGAAATGATCAAGTACTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-1774s21c1
Sequence:CCGGTGCGGCTTCTAAGACTATTTCCTCGAGGAAATAGTCTTAGAAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.2-1285s21c1
Sequence:CCGGCCGTCAGCCTGTGATACATACCTCGAGGTATGTATCACAGGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-509s21c1
Sequence:CCGGATGAGAACATGCCGCATAAATCTCGAGATTTATGCGGCATGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013703.1-3094s1c1
Sequence:CCGGCCAGCAATGAACCTTGTGCTACTCGAGTAGCACAAGGTTCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013703.1-426s1c1
Sequence:CCGGGCCAGTGTGTTCCTAACAGATCTCGAGATCTGTTAGGAACACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013703.1-367s1c1
Sequence:CCGGCGACGAGAAGAACTGTGTAAACTCGAGTTTACACAGTTCTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013703.1-1502s1c1
Sequence:CCGGCCGAGTCTGATCTTCACTAATCTCGAGATTAGTGAAGATCAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013703.1-1501s1c1
Sequence:CCGGGCCGAGTCTGATCTTCACTAACTCGAGTTAGTGAAGATCAGACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013703
VALIDATED
VLDLR MISSION shRNA Lentiviral Transduction Particles
very low density lipoprotein receptor
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.2-3416s21c1
Sequence:CCGGTGGATGTGGTTACCAAGTATCCTCGAGGATACTTGGTAACCACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013703.2-1702s21c1
Sequence:CCGGTATCTGCAAAGACCTAGTTATCTCGAGATAACTAGGTCTTTGCAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013703.1-1502s21c1
Sequence:CCGGCCGAGTCTGATCTTCACTAATCTCGAGATTAGTGAAGATCAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-1252s21c1
Sequence:CCGGCAACGAATGCCTGGTCAATAACTCGAGTTATTGACCAGGCATTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-2935s21c1
Sequence:CCGGAGTTTGAGTACTTGATCATTTCTCGAGAAATGATCAAGTACTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-1774s21c1
Sequence:CCGGTGCGGCTTCTAAGACTATTTCCTCGAGGAAATAGTCTTAGAAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.2-1285s21c1
Sequence:CCGGCCGTCAGCCTGTGATACATACCTCGAGGTATGTATCACAGGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013703.1-509s21c1
Sequence:CCGGATGAGAACATGCCGCATAAATCTCGAGATTTATGCGGCATGTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013703.1-3094s1c1
Sequence:CCGGCCAGCAATGAACCTTGTGCTACTCGAGTAGCACAAGGTTCATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013703.1-426s1c1
Sequence:CCGGGCCAGTGTGTTCCTAACAGATCTCGAGATCTGTTAGGAACACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013703.1-367s1c1
Sequence:CCGGCGACGAGAAGAACTGTGTAAACTCGAGTTTACACAGTTCTTCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013703.1-1502s1c1
Sequence:CCGGCCGAGTCTGATCTTCACTAATCTCGAGATTAGTGAAGATCAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013703.1-1501s1c1
Sequence:CCGGGCCGAGTCTGATCTTCACTAACTCGAGTTAGTGAAGATCAGACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks