EMAIL THIS PAGE TO A FRIEND

VMA21

VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)

Synonyms: MEAX XMEA
UniProtKB ID: Q3ZAQ7, A6NKV7, B3KUA9
Gene ID:
Human(203547) Summary: This gene encodes a chaperone for assembly of lysosomal vacuolar ATPase.[provided by RefSeq, Jul 2012]
Mouse(67048) VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
Rat(501658) VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
chicken(422385) VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
dog(481074) VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
domestic cat(101094832) VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
domestic guinea pig(100723580) VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
cow(613674) VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
sheep(101114589) VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44721 Anti-LOC203547 antibody produced in rabbit IgG fraction of antiserum bovine, human, rabbit, canine, mouse, rat
immunohistochemistry, western blot pricing
HPA010972 Anti-VMA21 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017980 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU150521 MISSION® esiRNA esiRNA targeting mouse Vma21 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017980 Rosetta Predictions human pricing
XM_001067193 Rosetta Predictions rat pricing
XM_577054 Rosetta Predictions rat pricing
NM_001081356 Rosetta Predictions mouse pricing
XM_898828 Rosetta Predictions mouse pricing
XM_898831 Rosetta Predictions mouse pricing
XM_898839 Rosetta Predictions mouse pricing
XM_898844 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037899 predicted 487
2 SASI_Hs01_00037901 predicted 247
3 SASI_Hs01_00037902 predicted 492
4 SASI_Hs01_00037904 predicted 748
5 SASI_Hs01_00037905 predicted 846
6 SASI_Hs02_00306869 predicted 438
7 SASI_Hs01_00037906 predicted 739
8 SASI_Hs01_00037907 predicted 876
9 SASI_Hs01_00037908 predicted 627
10 SASI_Hs02_00306870 predicted 462
11 SASI_Hs01_00037900 predicted 222
12 SASI_Hs01_00037903 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320181 predicted 376
2 SASI_Rn02_00320182 predicted 807
3 SASI_Rn02_00320183 predicted 705
4 SASI_Rn02_00320184 predicted 756
5 SASI_Rn02_00320185 predicted 555
6 SASI_Rn02_00320186 predicted 574
7 SASI_Rn02_00320187 predicted 598
8 SASI_Rn02_00320188 predicted 443
9 SASI_Rn02_00320189 predicted 416
10 SASI_Rn02_00320190 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406104 predicted 385
2 SASI_Rn02_00406105 predicted 813
3 SASI_Rn02_00406106 predicted 710
4 SASI_Rn02_00406107 predicted 753
5 SASI_Rn02_00406108 predicted 556
6 SASI_Rn02_00406109 predicted 579
7 SASI_Rn02_00406110 predicted 606
8 SASI_Rn02_00406111 predicted 450
9 SASI_Rn02_00406112 predicted 426
10 SASI_Rn02_00406113 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297611 predicted 638
2 SASI_Mm02_00297612 predicted 660
3 SASI_Mm02_00297613 predicted 528
4 SASI_Mm02_00297614 predicted 673
5 SASI_Mm02_00297615 predicted 218
6 SASI_Mm02_00297616 predicted 706
7 SASI_Mm02_00297617 predicted 910
8 SASI_Mm02_00297618 predicted 280
9 SASI_Mm02_00297619 predicted 207
10 SASI_Mm02_00297620 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223462 predicted 1129
2 SASI_Mm01_00223463 predicted 1015
3 SASI_Mm01_00223464 predicted 1063
4 SASI_Mm01_00223465 predicted 1161
5 SASI_Mm01_00223466 predicted 706
6 SASI_Mm01_00223467 predicted 1192
7 SASI_Mm01_00223468 predicted 1392
8 SASI_Mm01_00223469 predicted 761
9 SASI_Mm01_00223470 predicted 690
10 SASI_Mm01_00223471 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225655 predicted 665
2 SASI_Mm01_00225656 predicted 550
3 SASI_Mm01_00225657 predicted 598
4 SASI_Mm01_00225658 predicted 700
5 SASI_Mm01_00225659 predicted 251
6 SASI_Mm01_00225660 predicted 729
7 SASI_Mm01_00225661 predicted 934
8 SASI_Mm01_00225662 predicted 310
9 SASI_Mm01_00225663 predicted 230
10 SASI_Mm01_00225664 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208078 predicted 758
2 SASI_Mm01_00208079 predicted 637
3 SASI_Mm01_00208080 predicted 684
4 SASI_Mm01_00208081 predicted 784
5 SASI_Mm01_00208082 predicted 332
6 SASI_Mm01_00208083 predicted 814
7 SASI_Mm01_00208084 predicted 1019
8 SASI_Mm01_00208085 predicted 392
9 SASI_Mm01_00208086 predicted 315
10 SASI_Mm01_00208087 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898844 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241899 predicted 850
2 SASI_Mm01_00241900 predicted 738
3 SASI_Mm01_00241901 predicted 788
4 SASI_Mm01_00241902 predicted 881
5 SASI_Mm01_00241903 predicted 435
6 SASI_Mm01_00241904 predicted 912
7 SASI_Mm01_00241905 predicted 1113
8 SASI_Mm01_00241906 predicted 492
9 SASI_Mm01_00241907 predicted 413
10 SASI_Mm01_00241908 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017980
VMA21 MISSION shRNA Bacterial Glycerol Stock
VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017980.1-188s1c1
Sequence:CCGGGATCACTGTTCCTATTGGGTTCTCGAGAACCCAATAGGAACAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017980.1-114s1c1
Sequence:CCGGCAGCCTCCTGAGTTCAGAAATCTCGAGATTTCTGAACTCAGGAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017980.1-251s1c1
Sequence:CCGGGATGTCCAATAGGGACAGCTACTCGAGTAGCTGTCCCTATTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017980.1-2580s1c1
Sequence:CCGGGCGCCAAATGTTTGAAGGTTACTCGAGTAACCTTCAAACATTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017980.1-164s1c1
Sequence:CCGGGCTCCTGTTCTTCACAGCTTTCTCGAGAAAGCTGTGAAGAACAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017980.1-180s1c1
Sequence:CCGGGCTTTAATGATCACTGTTCCTCTCGAGAGGAACAGTGATCATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017980.1-2401s1c1
Sequence:CCGGCCAAGGTATTTCTTGTGCTTTCTCGAGAAAGCACAAGAAATACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017980
VMA21 MISSION shRNA shRNA Plasmid DNA
VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017980.1-188s1c1
Sequence:CCGGGATCACTGTTCCTATTGGGTTCTCGAGAACCCAATAGGAACAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017980.1-114s1c1
Sequence:CCGGCAGCCTCCTGAGTTCAGAAATCTCGAGATTTCTGAACTCAGGAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017980.1-251s1c1
Sequence:CCGGGATGTCCAATAGGGACAGCTACTCGAGTAGCTGTCCCTATTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017980.1-2580s1c1
Sequence:CCGGGCGCCAAATGTTTGAAGGTTACTCGAGTAACCTTCAAACATTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017980.1-164s1c1
Sequence:CCGGGCTCCTGTTCTTCACAGCTTTCTCGAGAAAGCTGTGAAGAACAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017980.1-180s1c1
Sequence:CCGGGCTTTAATGATCACTGTTCCTCTCGAGAGGAACAGTGATCATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017980.1-2401s1c1
Sequence:CCGGCCAAGGTATTTCTTGTGCTTTCTCGAGAAAGCACAAGAAATACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017980
VMA21 MISSION shRNA Lentiviral Transduction Particles
VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017980.1-188s1c1
Sequence:CCGGGATCACTGTTCCTATTGGGTTCTCGAGAACCCAATAGGAACAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017980.1-114s1c1
Sequence:CCGGCAGCCTCCTGAGTTCAGAAATCTCGAGATTTCTGAACTCAGGAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017980.1-251s1c1
Sequence:CCGGGATGTCCAATAGGGACAGCTACTCGAGTAGCTGTCCCTATTGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017980.1-2580s1c1
Sequence:CCGGGCGCCAAATGTTTGAAGGTTACTCGAGTAACCTTCAAACATTTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017980.1-164s1c1
Sequence:CCGGGCTCCTGTTCTTCACAGCTTTCTCGAGAAAGCTGTGAAGAACAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017980.1-180s1c1
Sequence:CCGGGCTTTAATGATCACTGTTCCTCTCGAGAGGAACAGTGATCATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017980.1-2401s1c1
Sequence:CCGGCCAAGGTATTTCTTGTGCTTTCTCGAGAAAGCACAAGAAATACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081356
VMA21 MISSION shRNA Bacterial Glycerol Stock
VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2200s21c1
Sequence:CCGGCCTTATTAGGTGGCCTATTATCTCGAGATAATAGGCCACCTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2681s21c1
Sequence:CCGGGATCCCAGTTAGGGAGTATAACTCGAGTTATACTCCCTAACTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2766s21c1
Sequence:CCGGCTGATATGCCTTCCGAATAATCTCGAGATTATTCGGAAGGCATATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2421s21c1
Sequence:CCGGACAATGTGTTTGACCATTAAACTCGAGTTTAATGGTCAAACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2710s21c1
Sequence:CCGGGTCCTTGCAAGCTACTAATTTCTCGAGAAATTAGTAGCTTGCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081356
VMA21 MISSION shRNA shRNA Plasmid DNA
VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2200s21c1
Sequence:CCGGCCTTATTAGGTGGCCTATTATCTCGAGATAATAGGCCACCTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2681s21c1
Sequence:CCGGGATCCCAGTTAGGGAGTATAACTCGAGTTATACTCCCTAACTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2766s21c1
Sequence:CCGGCTGATATGCCTTCCGAATAATCTCGAGATTATTCGGAAGGCATATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2421s21c1
Sequence:CCGGACAATGTGTTTGACCATTAAACTCGAGTTTAATGGTCAAACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2710s21c1
Sequence:CCGGGTCCTTGCAAGCTACTAATTTCTCGAGAAATTAGTAGCTTGCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081356
VMA21 MISSION shRNA Lentiviral Transduction Particles
VMA21 vacuolar H+-ATPase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2200s21c1
Sequence:CCGGCCTTATTAGGTGGCCTATTATCTCGAGATAATAGGCCACCTAATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2681s21c1
Sequence:CCGGGATCCCAGTTAGGGAGTATAACTCGAGTTATACTCCCTAACTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2766s21c1
Sequence:CCGGCTGATATGCCTTCCGAATAATCTCGAGATTATTCGGAAGGCATATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2421s21c1
Sequence:CCGGACAATGTGTTTGACCATTAAACTCGAGTTTAATGGTCAAACACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081356.2-2710s21c1
Sequence:CCGGGTCCTTGCAAGCTACTAATTTCTCGAGAAATTAGTAGCTTGCAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks