EMAIL THIS PAGE TO A FRIEND

VMAC

vimentin-type intermediate filament associated coiled-coil protein

UniProtKB ID: Q2NL98, B3KW55
Gene ID:
Mouse(106639) vimentin-type intermediate filament associated coiled-coil protein
Rat(363327) vimentin-type intermediate filament associated coiled-coil protein
cow(515212) vimentin-type intermediate filament associated coiled-coil protein
sheep(101108224) vimentin-type intermediate filament associated coiled-coil protein
domestic guinea pig(100718989) vimentin-type intermediate filament associated coiled-coil protein
naked mole-rat(101705625) vimentin-type intermediate filament associated coiled-coil protein
dog(611753) vimentin-type intermediate filament associated coiled-coil protein
domestic cat(101094159) vimentin-type intermediate filament associated coiled-coil protein
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017921 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017921 Rosetta Predictions human pricing
NM_001001720 Rosetta Predictions rat pricing
XM_579064 Rosetta Predictions rat pricing
NM_178926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200463 predicted 607
2 SASI_Hs01_00200464 predicted 621
3 SASI_Hs01_00200466 predicted 619
4 SASI_Hs01_00200467 predicted 567
5 SASI_Hs01_00200468 predicted 203
6 SASI_Hs01_00200469 predicted 503
7 SASI_Hs01_00200470 predicted 539
8 SASI_Hs02_00306805 predicted 617
9 SASI_Hs01_00200471 predicted 544
10 SASI_Hs01_00200472 predicted 525
11 SASI_Hs01_00200465 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046171 predicted 288
2 SASI_Rn01_00046172 predicted 283
3 SASI_Rn01_00046173 predicted 277
4 SASI_Rn01_00046174 predicted 288
5 SASI_Rn02_00197938 predicted 203
6 SASI_Rn02_00197939 predicted 473
7 SASI_Rn02_00197940 predicted 482
8 SASI_Rn02_00197941 predicted 444
9 SASI_Rn02_00197942 predicted 120
10 SASI_Rn02_00197943 predicted 408
11 SASI_Rn01_00046170 predicted 267
12 SASI_Rn01_00046175 predicted 264
13 SASI_Rn01_00046176 predicted 214
14 SASI_Rn01_00046177 predicted 243
15 SASI_Rn01_00046178 predicted 205
16 SASI_Rn01_00046179 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179658 predicted 264
2 SASI_Rn01_00179659 predicted 294
3 SASI_Rn01_00179660 predicted 293
4 SASI_Rn01_00179661 predicted 283
5 SASI_Rn01_00179662 predicted 296
6 SASI_Rn01_00179663 predicted 268
7 SASI_Rn01_00179664 predicted 212
8 SASI_Rn01_00179665 predicted 243
9 SASI_Rn01_00179666 predicted 211
10 SASI_Rn01_00179667 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152314 predicted 216
2 SASI_Mm01_00152315 predicted 470
3 SASI_Mm01_00152318 predicted 868
4 SASI_Mm01_00152319 predicted 530
5 SASI_Mm01_00152320 predicted 773
6 SASI_Mm01_00152321 predicted 912
7 SASI_Mm01_00152322 predicted 542
8 SASI_Mm01_00152323 predicted 425
9 SASI_Mm02_00349557 predicted 636
10 SASI_Mm02_00349558 predicted 794
11 SASI_Mm01_00152316 predicted 551
12 SASI_Mm01_00152317 predicted 885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017921
VMAC MISSION shRNA Bacterial Glycerol Stock
vimentin-type intermediate filament associated coiled-coil protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017921.3-270s21c1
Sequence:CCGGATGACCTCAGAAGCCACTGTCCTCGAGGACAGTGGCTTCTGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017921.3-856s21c1
Sequence:CCGGGAGTTCAGGGCACCCTCTTTACTCGAGTAAAGAGGGTGCCCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017921.3-742s21c1
Sequence:CCGGAGACAGAAGTGTTCTTGTTTGCTCGAGCAAACAAGAACACTTCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017921.1-540s1c1
Sequence:CCGGGATTACAGAATGGAGACAGAACTCGAGTTCTGTCTCCATTCTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017921.1-622s1c1
Sequence:CCGGGCCAAAGTCCTGTCTAAGCATCTCGAGATGCTTAGACAGGACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017921.1-529s1c1
Sequence:CCGGCCCGGAATGCAGATTACAGAACTCGAGTTCTGTAATCTGCATTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017921.1-618s1c1
Sequence:CCGGCAGAGCCAAAGTCCTGTCTAACTCGAGTTAGACAGGACTTTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017921.1-530s1c1
Sequence:CCGGCCGGAATGCAGATTACAGAATCTCGAGATTCTGTAATCTGCATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017921
VMAC MISSION shRNA shRNA Plasmid DNA
vimentin-type intermediate filament associated coiled-coil protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017921.3-270s21c1
Sequence:CCGGATGACCTCAGAAGCCACTGTCCTCGAGGACAGTGGCTTCTGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017921.3-856s21c1
Sequence:CCGGGAGTTCAGGGCACCCTCTTTACTCGAGTAAAGAGGGTGCCCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017921.3-742s21c1
Sequence:CCGGAGACAGAAGTGTTCTTGTTTGCTCGAGCAAACAAGAACACTTCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017921.1-540s1c1
Sequence:CCGGGATTACAGAATGGAGACAGAACTCGAGTTCTGTCTCCATTCTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017921.1-622s1c1
Sequence:CCGGGCCAAAGTCCTGTCTAAGCATCTCGAGATGCTTAGACAGGACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017921.1-529s1c1
Sequence:CCGGCCCGGAATGCAGATTACAGAACTCGAGTTCTGTAATCTGCATTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017921.1-618s1c1
Sequence:CCGGCAGAGCCAAAGTCCTGTCTAACTCGAGTTAGACAGGACTTTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017921.1-530s1c1
Sequence:CCGGCCGGAATGCAGATTACAGAATCTCGAGATTCTGTAATCTGCATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017921
VMAC MISSION shRNA Lentiviral Transduction Particles
vimentin-type intermediate filament associated coiled-coil protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017921.3-270s21c1
Sequence:CCGGATGACCTCAGAAGCCACTGTCCTCGAGGACAGTGGCTTCTGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017921.3-856s21c1
Sequence:CCGGGAGTTCAGGGCACCCTCTTTACTCGAGTAAAGAGGGTGCCCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017921.3-742s21c1
Sequence:CCGGAGACAGAAGTGTTCTTGTTTGCTCGAGCAAACAAGAACACTTCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017921.1-540s1c1
Sequence:CCGGGATTACAGAATGGAGACAGAACTCGAGTTCTGTCTCCATTCTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017921.1-622s1c1
Sequence:CCGGGCCAAAGTCCTGTCTAAGCATCTCGAGATGCTTAGACAGGACTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017921.1-529s1c1
Sequence:CCGGCCCGGAATGCAGATTACAGAACTCGAGTTCTGTAATCTGCATTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017921.1-618s1c1
Sequence:CCGGCAGAGCCAAAGTCCTGTCTAACTCGAGTTAGACAGGACTTTGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017921.1-530s1c1
Sequence:CCGGCCGGAATGCAGATTACAGAATCTCGAGATTCTGTAATCTGCATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178926
VMAC MISSION shRNA Bacterial Glycerol Stock
vimentin-type intermediate filament associated coiled-coil protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-1201s1c1
Sequence:CCGGCTACCCTTCTAGGAAGAACAACTCGAGTTGTTCTTCCTAGAAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-1149s1c1
Sequence:CCGGCCATCCTTAATGCCAAGACAACTCGAGTTGTCTTGGCATTAAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-656s1c1
Sequence:CCGGCCCATCTAAACATCACAACAACTCGAGTTGTTGTGATGTTTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-1498s1c1
Sequence:CCGGCAGTGCTAGTATGACAGGCTTCTCGAGAAGCCTGTCATACTAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-635s1c1
Sequence:CCGGGTCTTGAGAAATTACCCGGATCTCGAGATCCGGGTAATTTCTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1116s1c1
Sequence:CCGGCCTTTCTTTCTACTCACTCTTCTCGAGAAGAGTGAGTAGAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1379s1c1
Sequence:CCGGCTGTGATTGTTTGGTCTAGTTCTCGAGAACTAGACCAAACAATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1150s1c1
Sequence:CCGGCATCCTTAATGCCAAGACAAACTCGAGTTTGTCTTGGCATTAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-653s1c1
Sequence:CCGGGATCCCATCTAAACATCACAACTCGAGTTGTGATGTTTAGATGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1376s1c1
Sequence:CCGGGTACTGTGATTGTTTGGTCTACTCGAGTAGACCAAACAATCACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178926
VMAC MISSION shRNA shRNA Plasmid DNA
vimentin-type intermediate filament associated coiled-coil protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-1201s1c1
Sequence:CCGGCTACCCTTCTAGGAAGAACAACTCGAGTTGTTCTTCCTAGAAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-1149s1c1
Sequence:CCGGCCATCCTTAATGCCAAGACAACTCGAGTTGTCTTGGCATTAAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-656s1c1
Sequence:CCGGCCCATCTAAACATCACAACAACTCGAGTTGTTGTGATGTTTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-1498s1c1
Sequence:CCGGCAGTGCTAGTATGACAGGCTTCTCGAGAAGCCTGTCATACTAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-635s1c1
Sequence:CCGGGTCTTGAGAAATTACCCGGATCTCGAGATCCGGGTAATTTCTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1116s1c1
Sequence:CCGGCCTTTCTTTCTACTCACTCTTCTCGAGAAGAGTGAGTAGAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1379s1c1
Sequence:CCGGCTGTGATTGTTTGGTCTAGTTCTCGAGAACTAGACCAAACAATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1150s1c1
Sequence:CCGGCATCCTTAATGCCAAGACAAACTCGAGTTTGTCTTGGCATTAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-653s1c1
Sequence:CCGGGATCCCATCTAAACATCACAACTCGAGTTGTGATGTTTAGATGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1376s1c1
Sequence:CCGGGTACTGTGATTGTTTGGTCTACTCGAGTAGACCAAACAATCACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178926
VMAC MISSION shRNA Lentiviral Transduction Particles
vimentin-type intermediate filament associated coiled-coil protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-1201s1c1
Sequence:CCGGCTACCCTTCTAGGAAGAACAACTCGAGTTGTTCTTCCTAGAAGGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-1149s1c1
Sequence:CCGGCCATCCTTAATGCCAAGACAACTCGAGTTGTCTTGGCATTAAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198049    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-656s1c1
Sequence:CCGGCCCATCTAAACATCACAACAACTCGAGTTGTTGTGATGTTTAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182164    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-1498s1c1
Sequence:CCGGCAGTGCTAGTATGACAGGCTTCTCGAGAAGCCTGTCATACTAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181644    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178926.2-635s1c1
Sequence:CCGGGTCTTGAGAAATTACCCGGATCTCGAGATCCGGGTAATTTCTCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177754    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1116s1c1
Sequence:CCGGCCTTTCTTTCTACTCACTCTTCTCGAGAAGAGTGAGTAGAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1379s1c1
Sequence:CCGGCTGTGATTGTTTGGTCTAGTTCTCGAGAACTAGACCAAACAATCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1150s1c1
Sequence:CCGGCATCCTTAATGCCAAGACAAACTCGAGTTTGTCTTGGCATTAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-653s1c1
Sequence:CCGGGATCCCATCTAAACATCACAACTCGAGTTGTGATGTTTAGATGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178042    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178926.2-1376s1c1
Sequence:CCGGGTACTGTGATTGTTTGGTCTACTCGAGTAGACCAAACAATCACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks