EMAIL THIS PAGE TO A FRIEND

VMO1

vitelline membrane outer layer 1 homolog (chicken)

Synonyms: ERGA6350 PRO21055
UniProtKB ID: Q7Z5L0, C9JQ15, E9PAU9, E9PGP4, Q3SXP1, Q8IUY1
Gene ID:
Mouse(327956) vitelline membrane outer layer 1 homolog (chicken)
Rat(360553) vitelline membrane outer layer 1 homolog (chicken)
cow(526730) vitelline membrane outer layer 1 homolog (chicken)
sheep(101116070) vitelline membrane outer layer 1 homolog (chicken)
domestic guinea pig(100716709) vitelline membrane outer layer 1 homolog (chicken)
naked mole-rat(101712199) vitelline membrane outer layer 1 homolog (chicken)
chicken(418974) vitelline membrane outer layer 1 homolog (chicken)
domestic cat(101092652) vitelline membrane outer layer 1 homolog (chicken)
dog(489457) vitelline membrane outer layer 1 homolog (chicken)
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182566 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182566 Rosetta Predictions human pricing
XM_001079841 Rosetta Predictions rat pricing
XM_340832 Rosetta Predictions rat pricing
NM_001013607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194193 predicted 474
2 SASI_Hs01_00194194 predicted 361
3 SASI_Hs01_00194195 predicted 433
4 SASI_Hs01_00194196 predicted 471
5 SASI_Hs02_00370695 predicted 347
6 SASI_Hs01_00194198 predicted 368
7 SASI_Hs01_00194199 predicted 485
8 SASI_Hs01_00194200 predicted 474
9 SASI_Hs01_00194201 predicted 400
10 SASI_Hs01_00194202 predicted 352
11 SASI_Hs01_00194197 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365678 predicted 377
2 SASI_Rn02_00365679 predicted 352
3 SASI_Rn02_00365680 predicted 238
4 SASI_Rn02_00365681 predicted 362
5 SASI_Rn02_00365682 predicted 354
6 SASI_Rn02_00365683 predicted 323
7 SASI_Rn02_00365684 predicted 386
8 SASI_Rn02_00365685 predicted 295
9 SASI_Rn02_00365686 predicted 340
10 SASI_Rn02_00365687 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391959 predicted 375
2 SASI_Rn02_00391960 predicted 347
3 SASI_Rn02_00391961 predicted 241
4 SASI_Rn02_00391962 predicted 363
5 SASI_Rn02_00391963 predicted 354
6 SASI_Rn02_00391964 predicted 319
7 SASI_Rn02_00391965 predicted 385
8 SASI_Rn02_00391966 predicted 295
9 SASI_Rn02_00391967 predicted 341
10 SASI_Rn02_00391968 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123642 predicted 241
2 SASI_Mm01_00123643 predicted 379
3 SASI_Mm01_00123644 predicted 341
4 SASI_Mm01_00123645 predicted 217
5 SASI_Mm01_00123646 predicted 381
6 SASI_Mm01_00123647 predicted 266
7 SASI_Mm01_00123648 predicted 375
8 SASI_Mm01_00123649 predicted 386
9 SASI_Mm01_00123650 predicted 426
10 SASI_Mm02_00287250 predicted 296
11 SASI_Mm01_00123651 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013607
VMO1 MISSION shRNA Bacterial Glycerol Stock
vitelline membrane outer layer 1 homolog (chicken)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013607.1-509s1c1
Sequence:CCGGCAACTCATGTCCCAAAGGTGTCTCGAGACACCTTTGGGACATGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-358s1c1
Sequence:CCGGGCACTAGCTTCTTAGTGGCTTCTCGAGAAGCCACTAAGAAGCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-87s1c1
Sequence:CCGGGTTCACGTAGAACCACGCTATCTCGAGATAGCGTGGTTCTACGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-171s1c1
Sequence:CCGGCCTGATGGATACTTTGCCAGTCTCGAGACTGGCAAAGTATCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-75s1c1
Sequence:CCGGGCACAGATTCAAGTTCACGTACTCGAGTACGTGAACTTGAATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-160s1c1
Sequence:CCGGCTGAGATGTGTCCTGATGGATCTCGAGATCCATCAGGACACATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013607
VMO1 MISSION shRNA shRNA Plasmid DNA
vitelline membrane outer layer 1 homolog (chicken)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013607.1-509s1c1
Sequence:CCGGCAACTCATGTCCCAAAGGTGTCTCGAGACACCTTTGGGACATGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-358s1c1
Sequence:CCGGGCACTAGCTTCTTAGTGGCTTCTCGAGAAGCCACTAAGAAGCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-87s1c1
Sequence:CCGGGTTCACGTAGAACCACGCTATCTCGAGATAGCGTGGTTCTACGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-171s1c1
Sequence:CCGGCCTGATGGATACTTTGCCAGTCTCGAGACTGGCAAAGTATCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-75s1c1
Sequence:CCGGGCACAGATTCAAGTTCACGTACTCGAGTACGTGAACTTGAATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-160s1c1
Sequence:CCGGCTGAGATGTGTCCTGATGGATCTCGAGATCCATCAGGACACATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013607
VMO1 MISSION shRNA Lentiviral Transduction Particles
vitelline membrane outer layer 1 homolog (chicken)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013607.1-509s1c1
Sequence:CCGGCAACTCATGTCCCAAAGGTGTCTCGAGACACCTTTGGGACATGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-358s1c1
Sequence:CCGGGCACTAGCTTCTTAGTGGCTTCTCGAGAAGCCACTAAGAAGCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-87s1c1
Sequence:CCGGGTTCACGTAGAACCACGCTATCTCGAGATAGCGTGGTTCTACGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-171s1c1
Sequence:CCGGCCTGATGGATACTTTGCCAGTCTCGAGACTGGCAAAGTATCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-75s1c1
Sequence:CCGGGCACAGATTCAAGTTCACGTACTCGAGTACGTGAACTTGAATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013607.1-160s1c1
Sequence:CCGGCTGAGATGTGTCCTGATGGATCTCGAGATCCATCAGGACACATCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182566
VMO1 MISSION shRNA Bacterial Glycerol Stock
vitelline membrane outer layer 1 homolog (chicken)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-619s21c1
Sequence:CCGGACCAAGATCCAGGGACCTAGACTCGAGTCTAGGTCCCTGGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-238s21c1
Sequence:CCGGGAGATGTGTCCCGATGGATTCCTCGAGGAATCCATCGGGACACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-362s21c1
Sequence:CCGGTAGGCAATACGCACGTGGTAGCTCGAGCTACCACGTGCGTATTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-443s21c1
Sequence:CCGGACCTAGTGGCTTTCTCGCTTCCTCGAGGAAGCGAGAAAGCCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-489s21c1
Sequence:CCGGTGACAACACAGCAGCGAACAACTCGAGTTGTTCGCTGCTGTGTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182566
VMO1 MISSION shRNA shRNA Plasmid DNA
vitelline membrane outer layer 1 homolog (chicken)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-619s21c1
Sequence:CCGGACCAAGATCCAGGGACCTAGACTCGAGTCTAGGTCCCTGGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-238s21c1
Sequence:CCGGGAGATGTGTCCCGATGGATTCCTCGAGGAATCCATCGGGACACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-362s21c1
Sequence:CCGGTAGGCAATACGCACGTGGTAGCTCGAGCTACCACGTGCGTATTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-443s21c1
Sequence:CCGGACCTAGTGGCTTTCTCGCTTCCTCGAGGAAGCGAGAAAGCCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-489s21c1
Sequence:CCGGTGACAACACAGCAGCGAACAACTCGAGTTGTTCGCTGCTGTGTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182566
VMO1 MISSION shRNA Lentiviral Transduction Particles
vitelline membrane outer layer 1 homolog (chicken)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-619s21c1
Sequence:CCGGACCAAGATCCAGGGACCTAGACTCGAGTCTAGGTCCCTGGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-238s21c1
Sequence:CCGGGAGATGTGTCCCGATGGATTCCTCGAGGAATCCATCGGGACACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-362s21c1
Sequence:CCGGTAGGCAATACGCACGTGGTAGCTCGAGCTACCACGTGCGTATTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-443s21c1
Sequence:CCGGACCTAGTGGCTTTCTCGCTTCCTCGAGGAAGCGAGAAAGCCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182566.1-489s21c1
Sequence:CCGGTGACAACACAGCAGCGAACAACTCGAGTTGTTCGCTGCTGTGTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks